Incidental Mutation 'R5362:Csn2'
ID422863
Institutional Source Beutler Lab
Gene Symbol Csn2
Ensembl Gene ENSMUSG00000063157
Gene Namecasein beta
SynonymsCsnb, CSN2
MMRRC Submission 043264-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R5362 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location87692624-87699630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87694649 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 165 (H165L)
Ref Sequence ENSEMBL: ENSMUSP00000142673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082370] [ENSMUST00000196163] [ENSMUST00000196869] [ENSMUST00000197422] [ENSMUST00000198057] [ENSMUST00000199624]
Predicted Effect probably benign
Transcript: ENSMUST00000082370
AA Change: H172L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080976
Gene: ENSMUSG00000063157
AA Change: H172L

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Casein 142 221 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196163
AA Change: H165L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000142673
Gene: ENSMUSG00000063157
AA Change: H165L

DomainStartEndE-ValueType
Pfam:Casein 134 215 1.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196664
Predicted Effect probably benign
Transcript: ENSMUST00000196869
AA Change: H157L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142971
Gene: ENSMUSG00000063157
AA Change: H157L

DomainStartEndE-ValueType
Pfam:Casein 126 207 3.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197281
Predicted Effect probably benign
Transcript: ENSMUST00000197422
AA Change: H173L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143341
Gene: ENSMUSG00000063157
AA Change: H173L

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Casein 142 223 4.8e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197687
Predicted Effect probably benign
Transcript: ENSMUST00000198057
AA Change: H172L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143709
Gene: ENSMUSG00000063157
AA Change: H172L

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Casein 141 220 4.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199624
AA Change: H173L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143409
Gene: ENSMUSG00000063157
AA Change: H173L

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Casein 142 223 4.8e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200627
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta casein family. There are two types of casein protein, beta (encoded by this gene) and kappa, both of which are secreted in human milk. Beta casein is the principal protein in human milk and the primary source of essential amino acids for a suckling infant. Beta and kappa casein proteins acting together form spherical micelles which bind within them important dietary minerals, such as calcium and phosphorous. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Female mice homozygous for disruption of this gene produce mile with a low protein content and poor nutritional value. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A T 6: 133,294,482 D163V probably benign Het
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd17 G A 5: 90,265,545 A1170V probably damaging Het
Ano1 A C 7: 144,648,600 probably benign Het
Atl2 T C 17: 79,861,461 N37D probably damaging Het
C2cd5 T C 6: 143,083,243 Y90C probably damaging Het
Carm1 A G 9: 21,587,359 N499S probably benign Het
Ccdc47 G A 11: 106,208,213 probably null Het
Cd300lf G T 11: 115,117,114 L251M probably damaging Het
Cfap74 A G 4: 155,438,166 S670G probably damaging Het
Clec4a1 A G 6: 122,932,237 D188G probably damaging Het
Col4a1 T C 8: 11,245,760 probably benign Het
Dlx3 T C 11: 95,120,500 V60A possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam221a A G 6: 49,376,115 H21R probably damaging Het
Foxj3 T A 4: 119,620,143 H349Q unknown Het
Gm37240 G A 3: 84,515,693 T123I probably damaging Het
Gpc1 A T 1: 92,854,893 T121S probably benign Het
Ikbkap A C 4: 56,778,969 I616S probably damaging Het
Itga2b A G 11: 102,461,135 V512A probably damaging Het
Itgae A G 11: 73,111,849 Y144C probably damaging Het
Izumo3 A T 4: 92,146,800 I60K possibly damaging Het
Kif9 G A 9: 110,489,944 V159M probably damaging Het
Lrp1b T C 2: 41,375,902 D229G probably damaging Het
Nkpd1 G A 7: 19,523,268 G324D probably damaging Het
Nrp2 T A 1: 62,769,062 Y617N probably benign Het
Ocm T C 5: 144,023,856 D91G probably damaging Het
Olfr600 A G 7: 103,346,247 V227A probably damaging Het
Olfr667 A G 7: 104,916,627 I223T probably damaging Het
Olfr724 A G 14: 49,960,529 L181P possibly damaging Het
Olfr814 T C 10: 129,874,553 E68G probably damaging Het
Pex5l G A 3: 32,992,916 A295V probably damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Pou2f2 G A 7: 25,092,895 P512S probably benign Het
Prpf8 G A 11: 75,506,410 R2023Q possibly damaging Het
Ptprd A T 4: 76,128,813 S399R probably damaging Het
Qrich2 T C 11: 116,447,150 Y1889C probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ranbp6 G T 19: 29,811,728 T408K probably benign Het
Scn7a G A 2: 66,699,998 R668C probably damaging Het
Sertad4 T C 1: 192,847,106 N134S probably damaging Het
Spg11 G T 2: 122,061,000 N1963K probably damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Top2a T C 11: 99,018,912 N120S probably damaging Het
Trappc9 C T 15: 73,058,217 E97K possibly damaging Het
Vmn1r91 A T 7: 20,101,461 T102S probably benign Het
Vmn2r99 G T 17: 19,379,339 M428I probably benign Het
Zfp62 A T 11: 49,216,612 H510L probably damaging Het
Other mutations in Csn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Csn2 APN 5 87694773 missense probably benign 0.01
IGL01458:Csn2 APN 5 87696020 splice site probably benign
IGL01526:Csn2 APN 5 87694979 missense possibly damaging 0.92
IGL01588:Csn2 APN 5 87694649 missense probably benign 0.08
IGL02034:Csn2 APN 5 87696082 splice site probably benign
IGL02277:Csn2 APN 5 87698022 splice site probably benign
IGL03267:Csn2 APN 5 87698071 missense possibly damaging 0.85
R0730:Csn2 UTSW 5 87694952 missense possibly damaging 0.85
R1055:Csn2 UTSW 5 87694737 missense possibly damaging 0.93
R1488:Csn2 UTSW 5 87694896 nonsense probably null
R2076:Csn2 UTSW 5 87696174 missense probably damaging 0.99
R4039:Csn2 UTSW 5 87698076 start codon destroyed probably null 0.33
R4322:Csn2 UTSW 5 87698027 critical splice donor site probably null
R5207:Csn2 UTSW 5 87694962 nonsense probably null
R6191:Csn2 UTSW 5 87696026 critical splice donor site probably null
R6600:Csn2 UTSW 5 87694632 missense probably benign 0.25
R8054:Csn2 UTSW 5 87698027 critical splice donor site probably null
Z1088:Csn2 UTSW 5 87696009 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACTTACAGAAACGGAATGTTGTGG -3'
(R):5'- CAGGCTCAAACCATCTCTTGC -3'

Sequencing Primer
(F):5'- AACGGAATGTTGTGGAGTGGC -3'
(R):5'- GTCATTTCTCCTGAACTGGAATC -3'
Posted On2016-08-04