Incidental Mutation 'R5362:Ankrd17'
ID422864
Institutional Source Beutler Lab
Gene Symbol Ankrd17
Ensembl Gene ENSMUSG00000055204
Gene Nameankyrin repeat domain 17
SynonymsA130069E23Rik, 4933425K22Rik, Gtar
MMRRC Submission 043264-MU
Accession Numbers

Genbank: NM_030886, NM_198010; MGI: 1932101

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5362 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location90227166-90366577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90265545 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1170 (A1170V)
Ref Sequence ENSEMBL: ENSMUSP00000151446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014421] [ENSMUST00000081914] [ENSMUST00000168058] [ENSMUST00000197021] [ENSMUST00000218526]
Predicted Effect probably damaging
Transcript: ENSMUST00000014421
AA Change: A1170V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000014421
Gene: ENSMUSG00000055204
AA Change: A1170V

DomainStartEndE-ValueType
low complexity region 6 40 N/A INTRINSIC
low complexity region 55 71 N/A INTRINSIC
low complexity region 82 130 N/A INTRINSIC
ANK 229 258 8.62e1 SMART
ANK 262 291 3.31e-1 SMART
ANK 296 325 3.51e-5 SMART
ANK 329 358 1.33e-5 SMART
ANK 362 391 3.46e-4 SMART
ANK 396 425 3.23e-4 SMART
ANK 429 458 1.61e-4 SMART
ANK 462 491 1.46e-2 SMART
ANK 495 524 3.88e-7 SMART
ANK 529 558 4.19e-3 SMART
ANK 559 588 1.76e-5 SMART
ANK 592 621 3.51e-5 SMART
ANK 625 654 5.62e-4 SMART
ANK 659 688 1.29e-3 SMART
ANK 692 721 1.44e-1 SMART
coiled coil region 800 883 N/A INTRINSIC
low complexity region 890 903 N/A INTRINSIC
low complexity region 955 968 N/A INTRINSIC
low complexity region 986 997 N/A INTRINSIC
low complexity region 1046 1060 N/A INTRINSIC
ANK 1078 1107 2.13e-4 SMART
ANK 1111 1140 8.19e-6 SMART
ANK 1145 1174 1.68e-2 SMART
ANK 1178 1207 1.61e-4 SMART
ANK 1213 1242 1.43e-5 SMART
ANK 1247 1276 1.83e-3 SMART
ANK 1280 1309 3.91e-3 SMART
ANK 1315 1344 1.93e-2 SMART
ANK 1348 1377 8.78e-6 SMART
ANK 1381 1410 7.59e-1 SMART
coiled coil region 1454 1522 N/A INTRINSIC
low complexity region 1597 1611 N/A INTRINSIC
low complexity region 1616 1636 N/A INTRINSIC
KH 1720 1790 8.31e-14 SMART
low complexity region 1816 1827 N/A INTRINSIC
low complexity region 1834 1850 N/A INTRINSIC
low complexity region 1946 1989 N/A INTRINSIC
low complexity region 1996 2024 N/A INTRINSIC
low complexity region 2035 2052 N/A INTRINSIC
low complexity region 2068 2077 N/A INTRINSIC
low complexity region 2086 2110 N/A INTRINSIC
low complexity region 2175 2189 N/A INTRINSIC
low complexity region 2348 2365 N/A INTRINSIC
low complexity region 2392 2411 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081914
AA Change: A919V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080587
Gene: ENSMUSG00000055204
AA Change: A919V

DomainStartEndE-ValueType
low complexity region 6 40 N/A INTRINSIC
low complexity region 55 71 N/A INTRINSIC
low complexity region 82 130 N/A INTRINSIC
ANK 229 258 8.62e1 SMART
ANK 262 291 3.31e-1 SMART
ANK 296 325 3.51e-5 SMART
ANK 329 358 1.33e-5 SMART
ANK 362 391 3.46e-4 SMART
ANK 396 425 3.23e-4 SMART
ANK 429 458 1.61e-4 SMART
ANK 462 491 1.46e-2 SMART
ANK 495 524 3.88e-7 SMART
ANK 529 558 4.19e-3 SMART
ANK 559 588 1.76e-5 SMART
ANK 592 621 3.51e-5 SMART
ANK 625 654 5.62e-4 SMART
ANK 659 688 1.29e-3 SMART
ANK 692 721 1.44e-1 SMART
low complexity region 795 809 N/A INTRINSIC
ANK 827 856 2.13e-4 SMART
ANK 860 889 8.19e-6 SMART
ANK 894 923 1.68e-2 SMART
ANK 927 956 1.61e-4 SMART
ANK 962 991 1.43e-5 SMART
ANK 996 1025 1.83e-3 SMART
ANK 1029 1058 3.91e-3 SMART
ANK 1064 1093 1.93e-2 SMART
ANK 1097 1126 8.78e-6 SMART
ANK 1130 1159 7.59e-1 SMART
coiled coil region 1203 1271 N/A INTRINSIC
low complexity region 1346 1360 N/A INTRINSIC
low complexity region 1365 1385 N/A INTRINSIC
KH 1469 1539 8.31e-14 SMART
low complexity region 1565 1576 N/A INTRINSIC
low complexity region 1583 1599 N/A INTRINSIC
low complexity region 1695 1738 N/A INTRINSIC
low complexity region 1745 1773 N/A INTRINSIC
low complexity region 1784 1801 N/A INTRINSIC
low complexity region 1817 1826 N/A INTRINSIC
low complexity region 1835 1859 N/A INTRINSIC
low complexity region 1924 1938 N/A INTRINSIC
low complexity region 2097 2114 N/A INTRINSIC
low complexity region 2141 2160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000168058
AA Change: A1169V
SMART Domains Protein: ENSMUSP00000128960
Gene: ENSMUSG00000055204
AA Change: A1169V

DomainStartEndE-ValueType
low complexity region 6 40 N/A INTRINSIC
low complexity region 55 71 N/A INTRINSIC
low complexity region 82 130 N/A INTRINSIC
ANK 229 258 8.62e1 SMART
ANK 262 291 3.31e-1 SMART
ANK 296 325 3.51e-5 SMART
ANK 329 358 1.33e-5 SMART
ANK 362 391 3.46e-4 SMART
ANK 396 425 3.23e-4 SMART
ANK 429 458 1.61e-4 SMART
ANK 462 491 1.46e-2 SMART
ANK 495 524 3.88e-7 SMART
ANK 529 558 4.19e-3 SMART
ANK 559 588 1.76e-5 SMART
ANK 592 621 3.51e-5 SMART
ANK 625 654 5.62e-4 SMART
ANK 659 688 1.29e-3 SMART
ANK 692 721 1.44e-1 SMART
coiled coil region 800 883 N/A INTRINSIC
low complexity region 890 903 N/A INTRINSIC
low complexity region 955 968 N/A INTRINSIC
low complexity region 986 997 N/A INTRINSIC
low complexity region 1046 1060 N/A INTRINSIC
ANK 1078 1107 2.13e-4 SMART
ANK 1111 1140 8.19e-6 SMART
ANK 1145 1174 1.68e-2 SMART
ANK 1178 1207 1.61e-4 SMART
ANK 1213 1242 1.43e-5 SMART
ANK 1247 1276 1.83e-3 SMART
ANK 1280 1309 3.91e-3 SMART
ANK 1315 1344 1.93e-2 SMART
ANK 1348 1377 8.78e-6 SMART
ANK 1381 1410 7.59e-1 SMART
coiled coil region 1454 1522 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000197021
AA Change: A1061V
SMART Domains Protein: ENSMUSP00000142575
Gene: ENSMUSG00000055204
AA Change: A1061V

DomainStartEndE-ValueType
ANK 120 149 5.4e-1 SMART
ANK 153 182 2e-3 SMART
ANK 187 216 2.2e-7 SMART
ANK 220 249 8.2e-8 SMART
ANK 253 282 2.2e-6 SMART
ANK 287 316 2.1e-6 SMART
ANK 320 349 9.9e-7 SMART
ANK 353 382 9.5e-5 SMART
ANK 386 415 2.4e-9 SMART
ANK 420 449 2.6e-5 SMART
ANK 450 479 1.1e-7 SMART
ANK 483 512 2.2e-7 SMART
ANK 516 545 3.5e-6 SMART
ANK 550 579 7.9e-6 SMART
ANK 583 612 8.9e-4 SMART
coiled coil region 691 774 N/A INTRINSIC
low complexity region 781 794 N/A INTRINSIC
low complexity region 846 859 N/A INTRINSIC
low complexity region 877 888 N/A INTRINSIC
low complexity region 937 951 N/A INTRINSIC
ANK 969 998 1.4e-6 SMART
ANK 1002 1031 5.3e-8 SMART
ANK 1036 1065 1e-4 SMART
ANK 1069 1098 1e-6 SMART
ANK 1104 1133 9.1e-8 SMART
ANK 1138 1167 1.2e-5 SMART
ANK 1171 1200 2.5e-5 SMART
ANK 1206 1235 1.2e-4 SMART
ANK 1239 1268 5.5e-8 SMART
ANK 1272 1301 4.7e-3 SMART
coiled coil region 1345 1413 N/A INTRINSIC
low complexity region 1488 1502 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
KH 1611 1681 5.1e-16 SMART
low complexity region 1707 1718 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1837 1880 N/A INTRINSIC
low complexity region 1887 1915 N/A INTRINSIC
low complexity region 1926 1943 N/A INTRINSIC
low complexity region 1959 1968 N/A INTRINSIC
low complexity region 1977 2001 N/A INTRINSIC
low complexity region 2066 2080 N/A INTRINSIC
low complexity region 2239 2256 N/A INTRINSIC
low complexity region 2283 2302 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200012
Predicted Effect probably damaging
Transcript: ENSMUST00000218526
AA Change: A1170V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype Strain: 4360512
Lethality: E10-E12
FUNCTION: This gene encodes a protein with ankyrin repeats, which are associated with protein-protein interactions. Studies suggest that this protein is involved in liver development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with hemorrhages, impaired vascular smooth muscle cell development, impaired vascular integrity, and growth retardation. [provided by MGI curators]
Allele List at MGI

All alleles(133) : Targeted(4) Gene trapped(129)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A T 6: 133,294,482 D163V probably benign Het
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ano1 A C 7: 144,648,600 probably benign Het
Atl2 T C 17: 79,861,461 N37D probably damaging Het
C2cd5 T C 6: 143,083,243 Y90C probably damaging Het
Carm1 A G 9: 21,587,359 N499S probably benign Het
Ccdc47 G A 11: 106,208,213 probably null Het
Cd300lf G T 11: 115,117,114 L251M probably damaging Het
Cfap74 A G 4: 155,438,166 S670G probably damaging Het
Clec4a1 A G 6: 122,932,237 D188G probably damaging Het
Col4a1 T C 8: 11,245,760 probably benign Het
Csn2 T A 5: 87,694,649 H165L probably benign Het
Dlx3 T C 11: 95,120,500 V60A possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam221a A G 6: 49,376,115 H21R probably damaging Het
Foxj3 T A 4: 119,620,143 H349Q unknown Het
Gm37240 G A 3: 84,515,693 T123I probably damaging Het
Gpc1 A T 1: 92,854,893 T121S probably benign Het
Ikbkap A C 4: 56,778,969 I616S probably damaging Het
Itga2b A G 11: 102,461,135 V512A probably damaging Het
Itgae A G 11: 73,111,849 Y144C probably damaging Het
Izumo3 A T 4: 92,146,800 I60K possibly damaging Het
Kif9 G A 9: 110,489,944 V159M probably damaging Het
Lrp1b T C 2: 41,375,902 D229G probably damaging Het
Nkpd1 G A 7: 19,523,268 G324D probably damaging Het
Nrp2 T A 1: 62,769,062 Y617N probably benign Het
Ocm T C 5: 144,023,856 D91G probably damaging Het
Olfr600 A G 7: 103,346,247 V227A probably damaging Het
Olfr667 A G 7: 104,916,627 I223T probably damaging Het
Olfr724 A G 14: 49,960,529 L181P possibly damaging Het
Olfr814 T C 10: 129,874,553 E68G probably damaging Het
Pex5l G A 3: 32,992,916 A295V probably damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Pou2f2 G A 7: 25,092,895 P512S probably benign Het
Prpf8 G A 11: 75,506,410 R2023Q possibly damaging Het
Ptprd A T 4: 76,128,813 S399R probably damaging Het
Qrich2 T C 11: 116,447,150 Y1889C probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ranbp6 G T 19: 29,811,728 T408K probably benign Het
Scn7a G A 2: 66,699,998 R668C probably damaging Het
Sertad4 T C 1: 192,847,106 N134S probably damaging Het
Spg11 G T 2: 122,061,000 N1963K probably damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Top2a T C 11: 99,018,912 N120S probably damaging Het
Trappc9 C T 15: 73,058,217 E97K possibly damaging Het
Vmn1r91 A T 7: 20,101,461 T102S probably benign Het
Vmn2r99 G T 17: 19,379,339 M428I probably benign Het
Zfp62 A T 11: 49,216,612 H510L probably damaging Het
Other mutations in Ankrd17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ankrd17 APN 5 90233928 missense probably damaging 0.98
IGL00484:Ankrd17 APN 5 90268361 missense probably damaging 0.99
IGL01320:Ankrd17 APN 5 90260129 missense probably damaging 0.99
IGL01776:Ankrd17 APN 5 90283364 nonsense probably null
IGL02093:Ankrd17 APN 5 90242963 missense possibly damaging 0.93
IGL02292:Ankrd17 APN 5 90252859 unclassified probably benign
IGL02302:Ankrd17 APN 5 90283198 missense probably benign 0.23
IGL02472:Ankrd17 APN 5 90264151 missense probably damaging 1.00
IGL02705:Ankrd17 APN 5 90283115 missense probably benign 0.15
IGL02727:Ankrd17 APN 5 90244292 missense possibly damaging 0.93
IGL02884:Ankrd17 APN 5 90264757 missense probably damaging 1.00
3-1:Ankrd17 UTSW 5 90243154 missense probably damaging 0.99
PIT1430001:Ankrd17 UTSW 5 90252973 missense possibly damaging 0.91
R0025:Ankrd17 UTSW 5 90250405 missense probably damaging 0.99
R0076:Ankrd17 UTSW 5 90244406 nonsense probably null
R0076:Ankrd17 UTSW 5 90244406 nonsense probably null
R0271:Ankrd17 UTSW 5 90254799 missense possibly damaging 0.90
R0684:Ankrd17 UTSW 5 90263998 missense probably damaging 0.99
R1239:Ankrd17 UTSW 5 90288676 missense probably damaging 0.99
R1457:Ankrd17 UTSW 5 90285846 missense possibly damaging 0.92
R1505:Ankrd17 UTSW 5 90300026 missense possibly damaging 0.53
R1766:Ankrd17 UTSW 5 90264797 missense possibly damaging 0.95
R1770:Ankrd17 UTSW 5 90243376 missense possibly damaging 0.84
R1780:Ankrd17 UTSW 5 90232415 missense probably damaging 0.96
R1916:Ankrd17 UTSW 5 90260141 missense probably damaging 1.00
R1926:Ankrd17 UTSW 5 90244169 missense probably damaging 1.00
R2090:Ankrd17 UTSW 5 90298046 missense possibly damaging 0.92
R2153:Ankrd17 UTSW 5 90234059 missense probably damaging 0.98
R2279:Ankrd17 UTSW 5 90264717 missense probably damaging 1.00
R2420:Ankrd17 UTSW 5 90289320 missense possibly damaging 0.94
R3012:Ankrd17 UTSW 5 90230868 missense probably damaging 1.00
R3417:Ankrd17 UTSW 5 90243913 missense possibly damaging 0.86
R3704:Ankrd17 UTSW 5 90243969 missense possibly damaging 0.72
R4581:Ankrd17 UTSW 5 90283120 missense possibly damaging 0.67
R4850:Ankrd17 UTSW 5 90264786 missense probably damaging 1.00
R4926:Ankrd17 UTSW 5 90300032 missense probably damaging 1.00
R5023:Ankrd17 UTSW 5 90282868 missense probably damaging 1.00
R5068:Ankrd17 UTSW 5 90254808 missense probably damaging 0.96
R5109:Ankrd17 UTSW 5 90243536 missense possibly damaging 0.83
R5111:Ankrd17 UTSW 5 90242999 missense possibly damaging 0.85
R5214:Ankrd17 UTSW 5 90283460 missense possibly damaging 0.48
R5576:Ankrd17 UTSW 5 90243224 missense probably benign 0.00
R5615:Ankrd17 UTSW 5 90283436 missense possibly damaging 0.88
R5874:Ankrd17 UTSW 5 90268797 intron probably benign
R5932:Ankrd17 UTSW 5 90265436 missense probably damaging 1.00
R5944:Ankrd17 UTSW 5 90285843 missense probably damaging 1.00
R5993:Ankrd17 UTSW 5 90339672 intron probably benign
R6052:Ankrd17 UTSW 5 90253832 missense probably benign 0.03
R6088:Ankrd17 UTSW 5 90253688 missense possibly damaging 0.95
R6306:Ankrd17 UTSW 5 90244154 missense probably benign 0.03
R6418:Ankrd17 UTSW 5 90278345 missense possibly damaging 0.89
R6663:Ankrd17 UTSW 5 90264064 missense probably damaging 1.00
R6758:Ankrd17 UTSW 5 90263313 missense probably damaging 1.00
R6782:Ankrd17 UTSW 5 90254738 missense possibly damaging 0.91
R6793:Ankrd17 UTSW 5 90265512 missense probably damaging 1.00
R6929:Ankrd17 UTSW 5 90285525 missense possibly damaging 0.86
R7008:Ankrd17 UTSW 5 90260096 missense possibly damaging 0.93
R7051:Ankrd17 UTSW 5 90366451 unclassified probably benign
R7077:Ankrd17 UTSW 5 90285864 missense possibly damaging 0.92
R7134:Ankrd17 UTSW 5 90232314 missense probably damaging 0.99
R7134:Ankrd17 UTSW 5 90285523 missense probably benign 0.03
R7138:Ankrd17 UTSW 5 90242977 missense probably benign 0.38
R7143:Ankrd17 UTSW 5 90285961 missense possibly damaging 0.85
R7173:Ankrd17 UTSW 5 90260117 missense possibly damaging 0.95
R7176:Ankrd17 UTSW 5 90268735 missense probably damaging 0.99
R7365:Ankrd17 UTSW 5 90291151 missense possibly damaging 0.45
R7390:Ankrd17 UTSW 5 90282920 missense probably benign 0.13
R7430:Ankrd17 UTSW 5 90295657 missense possibly damaging 0.80
R7468:Ankrd17 UTSW 5 90243043 missense probably benign
R7483:Ankrd17 UTSW 5 90299996 missense probably benign 0.00
R7492:Ankrd17 UTSW 5 90233948 missense possibly damaging 0.85
R7610:Ankrd17 UTSW 5 90232363 missense possibly damaging 0.93
R7636:Ankrd17 UTSW 5 90232380 missense possibly damaging 0.53
R7790:Ankrd17 UTSW 5 90260152 missense possibly damaging 0.61
R7839:Ankrd17 UTSW 5 90263354 missense probably damaging 0.97
R7853:Ankrd17 UTSW 5 90238966 missense possibly damaging 0.91
R8054:Ankrd17 UTSW 5 90291055 missense probably benign 0.43
R8230:Ankrd17 UTSW 5 90243976 missense possibly damaging 0.86
R8274:Ankrd17 UTSW 5 90282859 missense probably benign 0.15
X0019:Ankrd17 UTSW 5 90298654 missense probably damaging 1.00
Z1177:Ankrd17 UTSW 5 90283505 missense possibly damaging 0.83
Z1177:Ankrd17 UTSW 5 90289325 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CTTTAGTACCCTAAGAAACAGCAG -3'
(R):5'- ATCTTCTGTGAGCTCTTTATAAGGC -3'

Sequencing Primer
(F):5'- ACAGCATTCTCCAAAGATTTATAGC -3'
(R):5'- AGCTCTTTATAAGGCTGTTGTCATC -3'
Posted On2016-08-04