Incidental Mutation 'R5362:Nkpd1'
ID422870
Institutional Source Beutler Lab
Gene Symbol Nkpd1
Ensembl Gene ENSMUSG00000060621
Gene NameNTPase, KAP family P-loop domain containing 1
Synonyms
MMRRC Submission 043264-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5362 (G1)
Quality Score207
Status Not validated
Chromosome7
Chromosomal Location19517838-19525056 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19523268 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 324 (G324D)
Ref Sequence ENSEMBL: ENSMUSP00000147092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078908] [ENSMUST00000207576] [ENSMUST00000214205]
Predicted Effect probably damaging
Transcript: ENSMUST00000078908
AA Change: G324D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077943
Gene: ENSMUSG00000060621
AA Change: G324D

DomainStartEndE-ValueType
low complexity region 71 103 N/A INTRINSIC
low complexity region 129 158 N/A INTRINSIC
Pfam:KAP_NTPase 186 642 5.7e-29 PFAM
low complexity region 771 780 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207576
AA Change: G324D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000214205
AA Change: G174D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A T 6: 133,294,482 D163V probably benign Het
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd17 G A 5: 90,265,545 A1170V probably damaging Het
Ano1 A C 7: 144,648,600 probably benign Het
Atl2 T C 17: 79,861,461 N37D probably damaging Het
C2cd5 T C 6: 143,083,243 Y90C probably damaging Het
Carm1 A G 9: 21,587,359 N499S probably benign Het
Ccdc47 G A 11: 106,208,213 probably null Het
Cd300lf G T 11: 115,117,114 L251M probably damaging Het
Cfap74 A G 4: 155,438,166 S670G probably damaging Het
Clec4a1 A G 6: 122,932,237 D188G probably damaging Het
Col4a1 T C 8: 11,245,760 probably benign Het
Csn2 T A 5: 87,694,649 H165L probably benign Het
Dlx3 T C 11: 95,120,500 V60A possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam221a A G 6: 49,376,115 H21R probably damaging Het
Foxj3 T A 4: 119,620,143 H349Q unknown Het
Gm37240 G A 3: 84,515,693 T123I probably damaging Het
Gpc1 A T 1: 92,854,893 T121S probably benign Het
Ikbkap A C 4: 56,778,969 I616S probably damaging Het
Itga2b A G 11: 102,461,135 V512A probably damaging Het
Itgae A G 11: 73,111,849 Y144C probably damaging Het
Izumo3 A T 4: 92,146,800 I60K possibly damaging Het
Kif9 G A 9: 110,489,944 V159M probably damaging Het
Lrp1b T C 2: 41,375,902 D229G probably damaging Het
Nrp2 T A 1: 62,769,062 Y617N probably benign Het
Ocm T C 5: 144,023,856 D91G probably damaging Het
Olfr600 A G 7: 103,346,247 V227A probably damaging Het
Olfr667 A G 7: 104,916,627 I223T probably damaging Het
Olfr724 A G 14: 49,960,529 L181P possibly damaging Het
Olfr814 T C 10: 129,874,553 E68G probably damaging Het
Pex5l G A 3: 32,992,916 A295V probably damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Pou2f2 G A 7: 25,092,895 P512S probably benign Het
Prpf8 G A 11: 75,506,410 R2023Q possibly damaging Het
Ptprd A T 4: 76,128,813 S399R probably damaging Het
Qrich2 T C 11: 116,447,150 Y1889C probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ranbp6 G T 19: 29,811,728 T408K probably benign Het
Scn7a G A 2: 66,699,998 R668C probably damaging Het
Sertad4 T C 1: 192,847,106 N134S probably damaging Het
Spg11 G T 2: 122,061,000 N1963K probably damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Top2a T C 11: 99,018,912 N120S probably damaging Het
Trappc9 C T 15: 73,058,217 E97K possibly damaging Het
Vmn1r91 A T 7: 20,101,461 T102S probably benign Het
Vmn2r99 G T 17: 19,379,339 M428I probably benign Het
Zfp62 A T 11: 49,216,612 H510L probably damaging Het
Other mutations in Nkpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Nkpd1 APN 7 19518749 missense possibly damaging 0.71
IGL01140:Nkpd1 APN 7 19523462 missense possibly damaging 0.72
IGL01450:Nkpd1 APN 7 19523625 missense probably damaging 1.00
R0003:Nkpd1 UTSW 7 19519927 missense probably benign
R0626:Nkpd1 UTSW 7 19523174 missense probably benign 0.02
R1171:Nkpd1 UTSW 7 19524087 missense possibly damaging 0.94
R1637:Nkpd1 UTSW 7 19523979 missense probably benign 0.00
R1722:Nkpd1 UTSW 7 19523921 missense possibly damaging 0.84
R1823:Nkpd1 UTSW 7 19523252 missense probably damaging 1.00
R2141:Nkpd1 UTSW 7 19524237 missense probably damaging 0.99
R2224:Nkpd1 UTSW 7 19519820 missense probably benign 0.00
R2225:Nkpd1 UTSW 7 19519820 missense probably benign 0.00
R2226:Nkpd1 UTSW 7 19519820 missense probably benign 0.00
R2274:Nkpd1 UTSW 7 19523897 missense probably benign 0.01
R2275:Nkpd1 UTSW 7 19523897 missense probably benign 0.01
R2374:Nkpd1 UTSW 7 19523975 missense possibly damaging 0.50
R3108:Nkpd1 UTSW 7 19522978 missense probably damaging 0.98
R4940:Nkpd1 UTSW 7 19523573 nonsense probably null
R5182:Nkpd1 UTSW 7 19523256 missense probably damaging 1.00
R5458:Nkpd1 UTSW 7 19524276 missense probably damaging 1.00
R5681:Nkpd1 UTSW 7 19523573 nonsense probably null
R5684:Nkpd1 UTSW 7 19523573 nonsense probably null
R5685:Nkpd1 UTSW 7 19523573 nonsense probably null
R6177:Nkpd1 UTSW 7 19523084 missense probably damaging 1.00
R6200:Nkpd1 UTSW 7 19524603 missense possibly damaging 0.55
R7348:Nkpd1 UTSW 7 19524416 missense probably damaging 0.99
R7356:Nkpd1 UTSW 7 19523774 missense probably damaging 1.00
R8239:Nkpd1 UTSW 7 19519828 missense probably benign
Z1177:Nkpd1 UTSW 7 19523777 missense probably damaging 1.00
Z1177:Nkpd1 UTSW 7 19523952 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTGCAGCCCGTGATCAC -3'
(R):5'- TCACGAACAGATGCTTGCCC -3'

Sequencing Primer
(F):5'- TGATCACGGAGCTGCACCTG -3'
(R):5'- AGATGCTTGCCCACGGAGTAC -3'
Posted On2016-08-04