Incidental Mutation 'R5362:Pou2f2'
ID422872
Institutional Source Beutler Lab
Gene Symbol Pou2f2
Ensembl Gene ENSMUSG00000008496
Gene NamePOU domain, class 2, transcription factor 2
SynonymsOct-2, Otf-2, Oct2a, Otf2, Oct2b
MMRRC Submission 043264-MU
Accession Numbers

Genbank: NM_001163554; MGI: 101897

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5362 (G1)
Quality Score213
Status Not validated
Chromosome7
Chromosomal Location25087344-25179726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25092895 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 512 (P512S)
Ref Sequence ENSEMBL: ENSMUSP00000104056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098679] [ENSMUST00000108413] [ENSMUST00000108415] [ENSMUST00000108416] [ENSMUST00000108417] [ENSMUST00000108418] [ENSMUST00000175774] [ENSMUST00000176408]
Predicted Effect probably benign
Transcript: ENSMUST00000098679
SMART Domains Protein: ENSMUSP00000096276
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
POU 201 275 7.65e-52 SMART
low complexity region 281 294 N/A INTRINSIC
HOX 303 365 3.8e-18 SMART
low complexity region 392 416 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108413
SMART Domains Protein: ENSMUSP00000104051
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 373 400 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108415
SMART Domains Protein: ENSMUSP00000104053
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 195 269 7.65e-52 SMART
low complexity region 275 288 N/A INTRINSIC
HOX 297 359 3.8e-18 SMART
low complexity region 386 410 N/A INTRINSIC
low complexity region 416 426 N/A INTRINSIC
low complexity region 427 450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108416
SMART Domains Protein: ENSMUSP00000104054
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 81 97 N/A INTRINSIC
POU 140 214 7.65e-52 SMART
low complexity region 220 233 N/A INTRINSIC
HOX 242 304 3.8e-18 SMART
low complexity region 331 355 N/A INTRINSIC
low complexity region 361 371 N/A INTRINSIC
low complexity region 372 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108417
SMART Domains Protein: ENSMUSP00000104055
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
POU 201 275 7.65e-52 SMART
low complexity region 281 294 N/A INTRINSIC
HOX 303 365 3.8e-18 SMART
low complexity region 392 416 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108418
AA Change: P512S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104056
Gene: ENSMUSG00000008496
AA Change: P512S

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 370 394 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 411 434 N/A INTRINSIC
low complexity region 490 509 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175774
SMART Domains Protein: ENSMUSP00000135075
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 370 394 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 411 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176408
SMART Domains Protein: ENSMUSP00000135326
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 195 269 7.65e-52 SMART
low complexity region 275 288 N/A INTRINSIC
HOX 297 359 3.8e-18 SMART
low complexity region 386 410 N/A INTRINSIC
low complexity region 416 426 N/A INTRINSIC
low complexity region 427 450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184150
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a homeobox-containing transcription factor of the POU domain family. The encoded protein binds the octamer sequence 5'-ATTTGCAT-3', a common transcription factor binding site in immunoglobulin gene promoters. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous inactivation of this locus results in failed B cell maturation and death within hours of birth. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Gene trapped(2)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A T 6: 133,294,482 D163V probably benign Het
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd17 G A 5: 90,265,545 A1170V probably damaging Het
Ano1 A C 7: 144,648,600 probably benign Het
Atl2 T C 17: 79,861,461 N37D probably damaging Het
C2cd5 T C 6: 143,083,243 Y90C probably damaging Het
Carm1 A G 9: 21,587,359 N499S probably benign Het
Ccdc47 G A 11: 106,208,213 probably null Het
Cd300lf G T 11: 115,117,114 L251M probably damaging Het
Cfap74 A G 4: 155,438,166 S670G probably damaging Het
Clec4a1 A G 6: 122,932,237 D188G probably damaging Het
Col4a1 T C 8: 11,245,760 probably benign Het
Csn2 T A 5: 87,694,649 H165L probably benign Het
Dlx3 T C 11: 95,120,500 V60A possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam221a A G 6: 49,376,115 H21R probably damaging Het
Foxj3 T A 4: 119,620,143 H349Q unknown Het
Gm37240 G A 3: 84,515,693 T123I probably damaging Het
Gpc1 A T 1: 92,854,893 T121S probably benign Het
Ikbkap A C 4: 56,778,969 I616S probably damaging Het
Itga2b A G 11: 102,461,135 V512A probably damaging Het
Itgae A G 11: 73,111,849 Y144C probably damaging Het
Izumo3 A T 4: 92,146,800 I60K possibly damaging Het
Kif9 G A 9: 110,489,944 V159M probably damaging Het
Lrp1b T C 2: 41,375,902 D229G probably damaging Het
Nkpd1 G A 7: 19,523,268 G324D probably damaging Het
Nrp2 T A 1: 62,769,062 Y617N probably benign Het
Ocm T C 5: 144,023,856 D91G probably damaging Het
Olfr600 A G 7: 103,346,247 V227A probably damaging Het
Olfr667 A G 7: 104,916,627 I223T probably damaging Het
Olfr724 A G 14: 49,960,529 L181P possibly damaging Het
Olfr814 T C 10: 129,874,553 E68G probably damaging Het
Pex5l G A 3: 32,992,916 A295V probably damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prpf8 G A 11: 75,506,410 R2023Q possibly damaging Het
Ptprd A T 4: 76,128,813 S399R probably damaging Het
Qrich2 T C 11: 116,447,150 Y1889C probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ranbp6 G T 19: 29,811,728 T408K probably benign Het
Scn7a G A 2: 66,699,998 R668C probably damaging Het
Sertad4 T C 1: 192,847,106 N134S probably damaging Het
Spg11 G T 2: 122,061,000 N1963K probably damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Top2a T C 11: 99,018,912 N120S probably damaging Het
Trappc9 C T 15: 73,058,217 E97K possibly damaging Het
Vmn1r91 A T 7: 20,101,461 T102S probably benign Het
Vmn2r99 G T 17: 19,379,339 M428I probably benign Het
Zfp62 A T 11: 49,216,612 H510L probably damaging Het
Other mutations in Pou2f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pou2f2 APN 7 25092700 nonsense probably null
IGL01420:Pou2f2 APN 7 25092952 missense possibly damaging 0.79
IGL02219:Pou2f2 APN 7 25097682 missense probably damaging 1.00
IGL03038:Pou2f2 APN 7 25097152 missense probably damaging 1.00
IGL03173:Pou2f2 APN 7 25099946 splice site probably benign
D3080:Pou2f2 UTSW 7 25097133 splice site probably benign
R0347:Pou2f2 UTSW 7 25097701 missense probably damaging 1.00
R0385:Pou2f2 UTSW 7 25116076 nonsense probably null
R0842:Pou2f2 UTSW 7 25096930 missense probably damaging 1.00
R1665:Pou2f2 UTSW 7 25092724 missense possibly damaging 0.66
R1914:Pou2f2 UTSW 7 25100156 missense possibly damaging 0.71
R1915:Pou2f2 UTSW 7 25100156 missense possibly damaging 0.71
R4076:Pou2f2 UTSW 7 25097288 missense probably damaging 0.98
R4811:Pou2f2 UTSW 7 25097686 nonsense probably null
R4863:Pou2f2 UTSW 7 25097108 intron probably benign
R5995:Pou2f2 UTSW 7 25097444 missense probably damaging 1.00
R6605:Pou2f2 UTSW 7 25093581 missense probably damaging 0.96
R7541:Pou2f2 UTSW 7 25116128 missense probably benign 0.02
R7884:Pou2f2 UTSW 7 25116064 missense probably benign 0.39
R8123:Pou2f2 UTSW 7 25097008 missense possibly damaging 0.83
RF014:Pou2f2 UTSW 7 25115737 missense unknown
Z1177:Pou2f2 UTSW 7 25093176 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCAAGGTCGGGAGATTCAG -3'
(R):5'- ATCTGTCTTCGGGAAAGGTG -3'

Sequencing Primer
(F):5'- ATGGCCGGCTCTCACTCAG -3'
(R):5'- TACTCAGGCAGGGTCCACAG -3'
Posted On2016-08-04