Incidental Mutation 'R5362:Olfr667'
ID422875
Institutional Source Beutler Lab
Gene Symbol Olfr667
Ensembl Gene ENSMUSG00000056782
Gene Nameolfactory receptor 667
SynonymsGA_x6K02T2PBJ9-7546146-7545166, MOR34-2, MOR34-11
MMRRC Submission 043264-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.677) question?
Stock #R5362 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104914742-104921482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104916627 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 223 (I223T)
Ref Sequence ENSEMBL: ENSMUSP00000150340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071362] [ENSMUST00000217177]
Predicted Effect probably damaging
Transcript: ENSMUST00000071362
AA Change: I223T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100470
Gene: ENSMUSG00000056782
AA Change: I223T

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 4.9e-102 PFAM
Pfam:7TM_GPCR_Srsx 37 310 1.2e-8 PFAM
Pfam:7tm_1 43 295 1.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211111
Predicted Effect probably damaging
Transcript: ENSMUST00000217177
AA Change: I223T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A T 6: 133,294,482 D163V probably benign Het
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd17 G A 5: 90,265,545 A1170V probably damaging Het
Ano1 A C 7: 144,648,600 probably benign Het
Atl2 T C 17: 79,861,461 N37D probably damaging Het
C2cd5 T C 6: 143,083,243 Y90C probably damaging Het
Carm1 A G 9: 21,587,359 N499S probably benign Het
Ccdc47 G A 11: 106,208,213 probably null Het
Cd300lf G T 11: 115,117,114 L251M probably damaging Het
Cfap74 A G 4: 155,438,166 S670G probably damaging Het
Clec4a1 A G 6: 122,932,237 D188G probably damaging Het
Col4a1 T C 8: 11,245,760 probably benign Het
Csn2 T A 5: 87,694,649 H165L probably benign Het
Dlx3 T C 11: 95,120,500 V60A possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam221a A G 6: 49,376,115 H21R probably damaging Het
Foxj3 T A 4: 119,620,143 H349Q unknown Het
Gm37240 G A 3: 84,515,693 T123I probably damaging Het
Gpc1 A T 1: 92,854,893 T121S probably benign Het
Ikbkap A C 4: 56,778,969 I616S probably damaging Het
Itga2b A G 11: 102,461,135 V512A probably damaging Het
Itgae A G 11: 73,111,849 Y144C probably damaging Het
Izumo3 A T 4: 92,146,800 I60K possibly damaging Het
Kif9 G A 9: 110,489,944 V159M probably damaging Het
Lrp1b T C 2: 41,375,902 D229G probably damaging Het
Nkpd1 G A 7: 19,523,268 G324D probably damaging Het
Nrp2 T A 1: 62,769,062 Y617N probably benign Het
Ocm T C 5: 144,023,856 D91G probably damaging Het
Olfr600 A G 7: 103,346,247 V227A probably damaging Het
Olfr724 A G 14: 49,960,529 L181P possibly damaging Het
Olfr814 T C 10: 129,874,553 E68G probably damaging Het
Pex5l G A 3: 32,992,916 A295V probably damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Pou2f2 G A 7: 25,092,895 P512S probably benign Het
Prpf8 G A 11: 75,506,410 R2023Q possibly damaging Het
Ptprd A T 4: 76,128,813 S399R probably damaging Het
Qrich2 T C 11: 116,447,150 Y1889C probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ranbp6 G T 19: 29,811,728 T408K probably benign Het
Scn7a G A 2: 66,699,998 R668C probably damaging Het
Sertad4 T C 1: 192,847,106 N134S probably damaging Het
Spg11 G T 2: 122,061,000 N1963K probably damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Top2a T C 11: 99,018,912 N120S probably damaging Het
Trappc9 C T 15: 73,058,217 E97K possibly damaging Het
Vmn1r91 A T 7: 20,101,461 T102S probably benign Het
Vmn2r99 G T 17: 19,379,339 M428I probably benign Het
Zfp62 A T 11: 49,216,612 H510L probably damaging Het
Other mutations in Olfr667
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02707:Olfr667 APN 7 104916652 missense probably damaging 1.00
R0457:Olfr667 UTSW 7 104916973 missense probably benign 0.19
R0684:Olfr667 UTSW 7 104916634 missense probably benign 0.21
R1343:Olfr667 UTSW 7 104916627 missense probably damaging 1.00
R1401:Olfr667 UTSW 7 104916756 missense probably damaging 1.00
R1415:Olfr667 UTSW 7 104916336 missense probably benign 0.03
R1644:Olfr667 UTSW 7 104916808 missense probably benign 0.02
R1907:Olfr667 UTSW 7 104917065 missense probably damaging 0.99
R2063:Olfr667 UTSW 7 104916775 missense probably benign 0.02
R3774:Olfr667 UTSW 7 104916906 missense probably benign 0.01
R4751:Olfr667 UTSW 7 104916410 nonsense probably null
R4958:Olfr667 UTSW 7 104916461 missense probably damaging 0.97
R4960:Olfr667 UTSW 7 104916708 missense probably benign 0.02
R5988:Olfr667 UTSW 7 104916918 missense probably damaging 0.98
R7396:Olfr667 UTSW 7 104916351 missense probably benign
R8169:Olfr667 UTSW 7 104916412 missense possibly damaging 0.60
Z1088:Olfr667 UTSW 7 104916666 missense probably benign 0.06
Z1177:Olfr667 UTSW 7 104917119 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGCAATAACAGATAGAGGTTTGCC -3'
(R):5'- GAGTGTGGCATTCATCCTTCC -3'

Sequencing Primer
(F):5'- CAGATAGAGGTTTGCCACTATGATG -3'
(R):5'- ACTTTCCTCACTAAGCGCCTG -3'
Posted On2016-08-04