Incidental Mutation 'R5362:Olfr814'
ID422883
Institutional Source Beutler Lab
Gene Symbol Olfr814
Ensembl Gene ENSMUSG00000059134
Gene Nameolfactory receptor 814
SynonymsMOR113-5, MOR113-8, GA_x6K02T2PULF-11553313-11552381
MMRRC Submission 043264-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5362 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129871473-129879851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129874553 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 68 (E68G)
Ref Sequence ENSEMBL: ENSMUSP00000150458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081367] [ENSMUST00000213742] [ENSMUST00000216966]
Predicted Effect probably damaging
Transcript: ENSMUST00000081367
AA Change: E68G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080106
Gene: ENSMUSG00000059134
AA Change: E68G

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.2e-47 PFAM
Pfam:7tm_1 39 288 1.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213742
AA Change: E68G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216966
AA Change: E68G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A T 6: 133,294,482 D163V probably benign Het
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd17 G A 5: 90,265,545 A1170V probably damaging Het
Ano1 A C 7: 144,648,600 probably benign Het
Atl2 T C 17: 79,861,461 N37D probably damaging Het
C2cd5 T C 6: 143,083,243 Y90C probably damaging Het
Carm1 A G 9: 21,587,359 N499S probably benign Het
Ccdc47 G A 11: 106,208,213 probably null Het
Cd300lf G T 11: 115,117,114 L251M probably damaging Het
Cfap74 A G 4: 155,438,166 S670G probably damaging Het
Clec4a1 A G 6: 122,932,237 D188G probably damaging Het
Col4a1 T C 8: 11,245,760 probably benign Het
Csn2 T A 5: 87,694,649 H165L probably benign Het
Dlx3 T C 11: 95,120,500 V60A possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam221a A G 6: 49,376,115 H21R probably damaging Het
Foxj3 T A 4: 119,620,143 H349Q unknown Het
Gm37240 G A 3: 84,515,693 T123I probably damaging Het
Gpc1 A T 1: 92,854,893 T121S probably benign Het
Ikbkap A C 4: 56,778,969 I616S probably damaging Het
Itga2b A G 11: 102,461,135 V512A probably damaging Het
Itgae A G 11: 73,111,849 Y144C probably damaging Het
Izumo3 A T 4: 92,146,800 I60K possibly damaging Het
Kif9 G A 9: 110,489,944 V159M probably damaging Het
Lrp1b T C 2: 41,375,902 D229G probably damaging Het
Nkpd1 G A 7: 19,523,268 G324D probably damaging Het
Nrp2 T A 1: 62,769,062 Y617N probably benign Het
Ocm T C 5: 144,023,856 D91G probably damaging Het
Olfr600 A G 7: 103,346,247 V227A probably damaging Het
Olfr667 A G 7: 104,916,627 I223T probably damaging Het
Olfr724 A G 14: 49,960,529 L181P possibly damaging Het
Pex5l G A 3: 32,992,916 A295V probably damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Pou2f2 G A 7: 25,092,895 P512S probably benign Het
Prpf8 G A 11: 75,506,410 R2023Q possibly damaging Het
Ptprd A T 4: 76,128,813 S399R probably damaging Het
Qrich2 T C 11: 116,447,150 Y1889C probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ranbp6 G T 19: 29,811,728 T408K probably benign Het
Scn7a G A 2: 66,699,998 R668C probably damaging Het
Sertad4 T C 1: 192,847,106 N134S probably damaging Het
Spg11 G T 2: 122,061,000 N1963K probably damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Top2a T C 11: 99,018,912 N120S probably damaging Het
Trappc9 C T 15: 73,058,217 E97K possibly damaging Het
Vmn1r91 A T 7: 20,101,461 T102S probably benign Het
Vmn2r99 G T 17: 19,379,339 M428I probably benign Het
Zfp62 A T 11: 49,216,612 H510L probably damaging Het
Other mutations in Olfr814
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01831:Olfr814 APN 10 129874031 missense probably damaging 1.00
IGL02045:Olfr814 APN 10 129874222 missense probably benign 0.22
IGL02301:Olfr814 APN 10 129874079 missense probably damaging 0.99
R0277:Olfr814 UTSW 10 129874067 missense probably damaging 0.99
R0281:Olfr814 UTSW 10 129874546 missense possibly damaging 0.88
R0323:Olfr814 UTSW 10 129874067 missense probably damaging 0.99
R0394:Olfr814 UTSW 10 129873942 missense probably benign 0.29
R0546:Olfr814 UTSW 10 129874538 missense possibly damaging 0.94
R3813:Olfr814 UTSW 10 129873986 missense probably damaging 1.00
R4086:Olfr814 UTSW 10 129874298 missense possibly damaging 0.49
R4415:Olfr814 UTSW 10 129873957 missense probably benign 0.00
R4416:Olfr814 UTSW 10 129873957 missense probably benign 0.00
R4453:Olfr814 UTSW 10 129874661 missense probably null 0.30
R5194:Olfr814 UTSW 10 129874098 missense probably benign 0.00
R5306:Olfr814 UTSW 10 129873941 missense probably damaging 0.97
R5609:Olfr814 UTSW 10 129874738 missense probably benign 0.01
R5987:Olfr814 UTSW 10 129874521 missense probably damaging 0.98
R6240:Olfr814 UTSW 10 129874677 missense probably benign
R6896:Olfr814 UTSW 10 129874754 start codon destroyed probably null 0.98
R7432:Olfr814 UTSW 10 129873850 missense probably benign
R7489:Olfr814 UTSW 10 129874682 missense probably damaging 1.00
R7652:Olfr814 UTSW 10 129874477 missense probably damaging 0.99
R8316:Olfr814 UTSW 10 129874022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCAATATAGCGGTCATAGG -3'
(R):5'- TGGTCGTACATATACTCATGTGG -3'

Sequencing Primer
(F):5'- CGGTCATAGGACATGGTAGCC -3'
(R):5'- AGACAGATAGAGTTTATCCTTCTTGG -3'
Posted On2016-08-04