Incidental Mutation 'R5362:Fam196b'
ID422884
Institutional Source Beutler Lab
Gene Symbol Fam196b
Ensembl Gene ENSMUSG00000069911
Gene Namefamily with sequence similarity 196, member B
SynonymsGm6041
MMRRC Submission 043264-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5362 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location34314822-34422640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34402788 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 277 (E277K)
Ref Sequence ENSEMBL: ENSMUSP00000129183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093192] [ENSMUST00000093193] [ENSMUST00000101364] [ENSMUST00000101365] [ENSMUST00000165963]
Predicted Effect probably damaging
Transcript: ENSMUST00000093192
AA Change: E277K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090883
Gene: ENSMUSG00000069911
AA Change: E277K

DomainStartEndE-ValueType
Pfam:FAM196 1 535 3.6e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093193
SMART Domains Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 2e-113 PFAM
Pfam:DOCK-C2 419 616 1e-60 PFAM
Pfam:DHR-2 1114 1614 6.3e-96 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101364
Predicted Effect probably benign
Transcript: ENSMUST00000101365
SMART Domains Protein: ENSMUSP00000098916
Gene: ENSMUSG00000020143

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 1.4e-113 PFAM
Pfam:DOCK-C2 419 616 5.5e-61 PFAM
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165963
AA Change: E277K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129183
Gene: ENSMUSG00000069911
AA Change: E277K

DomainStartEndE-ValueType
Pfam:FAM196 3 535 1.3e-168 PFAM
Meta Mutation Damage Score 0.0689 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A T 6: 133,294,482 D163V probably benign Het
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd17 G A 5: 90,265,545 A1170V probably damaging Het
Ano1 A C 7: 144,648,600 probably benign Het
Atl2 T C 17: 79,861,461 N37D probably damaging Het
C2cd5 T C 6: 143,083,243 Y90C probably damaging Het
Carm1 A G 9: 21,587,359 N499S probably benign Het
Ccdc47 G A 11: 106,208,213 probably null Het
Cd300lf G T 11: 115,117,114 L251M probably damaging Het
Cfap74 A G 4: 155,438,166 S670G probably damaging Het
Clec4a1 A G 6: 122,932,237 D188G probably damaging Het
Col4a1 T C 8: 11,245,760 probably benign Het
Csn2 T A 5: 87,694,649 H165L probably benign Het
Dlx3 T C 11: 95,120,500 V60A possibly damaging Het
Fam221a A G 6: 49,376,115 H21R probably damaging Het
Foxj3 T A 4: 119,620,143 H349Q unknown Het
Gm37240 G A 3: 84,515,693 T123I probably damaging Het
Gpc1 A T 1: 92,854,893 T121S probably benign Het
Ikbkap A C 4: 56,778,969 I616S probably damaging Het
Itga2b A G 11: 102,461,135 V512A probably damaging Het
Itgae A G 11: 73,111,849 Y144C probably damaging Het
Izumo3 A T 4: 92,146,800 I60K possibly damaging Het
Kif9 G A 9: 110,489,944 V159M probably damaging Het
Lrp1b T C 2: 41,375,902 D229G probably damaging Het
Nkpd1 G A 7: 19,523,268 G324D probably damaging Het
Nrp2 T A 1: 62,769,062 Y617N probably benign Het
Ocm T C 5: 144,023,856 D91G probably damaging Het
Olfr600 A G 7: 103,346,247 V227A probably damaging Het
Olfr667 A G 7: 104,916,627 I223T probably damaging Het
Olfr724 A G 14: 49,960,529 L181P possibly damaging Het
Olfr814 T C 10: 129,874,553 E68G probably damaging Het
Pex5l G A 3: 32,992,916 A295V probably damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Pou2f2 G A 7: 25,092,895 P512S probably benign Het
Prpf8 G A 11: 75,506,410 R2023Q possibly damaging Het
Ptprd A T 4: 76,128,813 S399R probably damaging Het
Qrich2 T C 11: 116,447,150 Y1889C probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ranbp6 G T 19: 29,811,728 T408K probably benign Het
Scn7a G A 2: 66,699,998 R668C probably damaging Het
Sertad4 T C 1: 192,847,106 N134S probably damaging Het
Spg11 G T 2: 122,061,000 N1963K probably damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Top2a T C 11: 99,018,912 N120S probably damaging Het
Trappc9 C T 15: 73,058,217 E97K possibly damaging Het
Vmn1r91 A T 7: 20,101,461 T102S probably benign Het
Vmn2r99 G T 17: 19,379,339 M428I probably benign Het
Zfp62 A T 11: 49,216,612 H510L probably damaging Het
Other mutations in Fam196b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Fam196b APN 11 34403011 missense probably benign
IGL01867:Fam196b APN 11 34403065 missense probably benign 0.39
PIT4677001:Fam196b UTSW 11 34403122 missense probably benign
R0317:Fam196b UTSW 11 34402826 missense possibly damaging 0.94
R1165:Fam196b UTSW 11 34402740 missense probably benign
R1710:Fam196b UTSW 11 34404263 splice site probably null
R2083:Fam196b UTSW 11 34402141 missense probably benign 0.01
R2096:Fam196b UTSW 11 34402936 missense probably benign 0.03
R3820:Fam196b UTSW 11 34403007 missense probably benign 0.01
R3821:Fam196b UTSW 11 34403007 missense probably benign 0.01
R3822:Fam196b UTSW 11 34403007 missense probably benign 0.01
R3969:Fam196b UTSW 11 34419739 missense probably damaging 0.99
R3970:Fam196b UTSW 11 34419739 missense probably damaging 0.99
R3980:Fam196b UTSW 11 34402678 missense probably benign 0.00
R4092:Fam196b UTSW 11 34401935 start gained probably benign
R4231:Fam196b UTSW 11 34403143 missense probably benign 0.01
R4678:Fam196b UTSW 11 34403227 missense probably damaging 1.00
R4859:Fam196b UTSW 11 34403154 missense probably benign 0.31
R4938:Fam196b UTSW 11 34402231 missense probably damaging 0.98
R5269:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5287:Fam196b UTSW 11 34403058 missense probably benign 0.12
R5358:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5359:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5361:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5363:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5403:Fam196b UTSW 11 34403058 missense probably benign 0.12
R5705:Fam196b UTSW 11 34404349 missense probably damaging 1.00
R6282:Fam196b UTSW 11 34402819 missense possibly damaging 0.77
R7030:Fam196b UTSW 11 34402030 missense probably damaging 0.96
R7069:Fam196b UTSW 11 34402677 missense possibly damaging 0.48
R7178:Fam196b UTSW 11 34402359 missense probably damaging 0.96
R7180:Fam196b UTSW 11 34419873 missense probably damaging 1.00
R7718:Fam196b UTSW 11 34402539 missense probably benign 0.00
R7789:Fam196b UTSW 11 34402537 missense probably benign
R7832:Fam196b UTSW 11 34403034 missense probably benign
R8377:Fam196b UTSW 11 34401964 missense probably damaging 1.00
Z1177:Fam196b UTSW 11 34402725 missense probably benign 0.01
Z1177:Fam196b UTSW 11 34403188 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGGGAAGCTAGAGAGTC -3'
(R):5'- TGCTACTTCTGAGTGACTCCAG -3'

Sequencing Primer
(F):5'- GGAAGCTAGAGAGTCGGCTC -3'
(R):5'- TCTGAGTGACTCCAGGTCCTG -3'
Posted On2016-08-04