Incidental Mutation 'R5362:Zfp62'
ID422885
Institutional Source Beutler Lab
Gene Symbol Zfp62
Ensembl Gene ENSMUSG00000046311
Gene Namezinc finger protein 62
Synonyms
MMRRC Submission 043264-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R5362 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49203292-49218816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49216612 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 510 (H510L)
Ref Sequence ENSEMBL: ENSMUSP00000137583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061757] [ENSMUST00000109197] [ENSMUST00000109198] [ENSMUST00000133150] [ENSMUST00000136539] [ENSMUST00000136691] [ENSMUST00000137061] [ENSMUST00000150284] [ENSMUST00000151228] [ENSMUST00000180016]
Predicted Effect probably damaging
Transcript: ENSMUST00000061757
AA Change: H510L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056226
Gene: ENSMUSG00000046311
AA Change: H510L

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109197
AA Change: H510L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104820
Gene: ENSMUSG00000046311
AA Change: H510L

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109198
AA Change: H510L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104821
Gene: ENSMUSG00000046311
AA Change: H510L

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128932
Predicted Effect probably benign
Transcript: ENSMUST00000133150
Predicted Effect probably damaging
Transcript: ENSMUST00000136539
AA Change: H510L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116045
Gene: ENSMUSG00000046311
AA Change: H510L

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136691
Predicted Effect probably benign
Transcript: ENSMUST00000137061
Predicted Effect probably benign
Transcript: ENSMUST00000150284
Predicted Effect probably benign
Transcript: ENSMUST00000151228
SMART Domains Protein: ENSMUSP00000117774
Gene: ENSMUSG00000046311

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
Pfam:zf-C2H2_6 179 195 2.3e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157023
Predicted Effect probably damaging
Transcript: ENSMUST00000180016
AA Change: H510L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137583
Gene: ENSMUSG00000046311
AA Change: H510L

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A T 6: 133,294,482 D163V probably benign Het
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd17 G A 5: 90,265,545 A1170V probably damaging Het
Ano1 A C 7: 144,648,600 probably benign Het
Atl2 T C 17: 79,861,461 N37D probably damaging Het
C2cd5 T C 6: 143,083,243 Y90C probably damaging Het
Carm1 A G 9: 21,587,359 N499S probably benign Het
Ccdc47 G A 11: 106,208,213 probably null Het
Cd300lf G T 11: 115,117,114 L251M probably damaging Het
Cfap74 A G 4: 155,438,166 S670G probably damaging Het
Clec4a1 A G 6: 122,932,237 D188G probably damaging Het
Col4a1 T C 8: 11,245,760 probably benign Het
Csn2 T A 5: 87,694,649 H165L probably benign Het
Dlx3 T C 11: 95,120,500 V60A possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam221a A G 6: 49,376,115 H21R probably damaging Het
Foxj3 T A 4: 119,620,143 H349Q unknown Het
Gm37240 G A 3: 84,515,693 T123I probably damaging Het
Gpc1 A T 1: 92,854,893 T121S probably benign Het
Ikbkap A C 4: 56,778,969 I616S probably damaging Het
Itga2b A G 11: 102,461,135 V512A probably damaging Het
Itgae A G 11: 73,111,849 Y144C probably damaging Het
Izumo3 A T 4: 92,146,800 I60K possibly damaging Het
Kif9 G A 9: 110,489,944 V159M probably damaging Het
Lrp1b T C 2: 41,375,902 D229G probably damaging Het
Nkpd1 G A 7: 19,523,268 G324D probably damaging Het
Nrp2 T A 1: 62,769,062 Y617N probably benign Het
Ocm T C 5: 144,023,856 D91G probably damaging Het
Olfr600 A G 7: 103,346,247 V227A probably damaging Het
Olfr667 A G 7: 104,916,627 I223T probably damaging Het
Olfr724 A G 14: 49,960,529 L181P possibly damaging Het
Olfr814 T C 10: 129,874,553 E68G probably damaging Het
Pex5l G A 3: 32,992,916 A295V probably damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Pou2f2 G A 7: 25,092,895 P512S probably benign Het
Prpf8 G A 11: 75,506,410 R2023Q possibly damaging Het
Ptprd A T 4: 76,128,813 S399R probably damaging Het
Qrich2 T C 11: 116,447,150 Y1889C probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ranbp6 G T 19: 29,811,728 T408K probably benign Het
Scn7a G A 2: 66,699,998 R668C probably damaging Het
Sertad4 T C 1: 192,847,106 N134S probably damaging Het
Spg11 G T 2: 122,061,000 N1963K probably damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Top2a T C 11: 99,018,912 N120S probably damaging Het
Trappc9 C T 15: 73,058,217 E97K possibly damaging Het
Vmn1r91 A T 7: 20,101,461 T102S probably benign Het
Vmn2r99 G T 17: 19,379,339 M428I probably benign Het
Other mutations in Zfp62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03342:Zfp62 APN 11 49215471 nonsense probably null
R0416:Zfp62 UTSW 11 49215676 missense probably damaging 1.00
R0540:Zfp62 UTSW 11 49215400 missense probably benign
R0607:Zfp62 UTSW 11 49215400 missense probably benign
R1119:Zfp62 UTSW 11 49216690 missense probably damaging 0.99
R1230:Zfp62 UTSW 11 49215099 missense probably damaging 0.96
R1644:Zfp62 UTSW 11 49215769 missense probably damaging 0.99
R1710:Zfp62 UTSW 11 49217683 missense probably benign
R1840:Zfp62 UTSW 11 49216388 missense probably damaging 1.00
R1908:Zfp62 UTSW 11 49216220 missense probably damaging 0.99
R3878:Zfp62 UTSW 11 49215133 missense probably damaging 0.99
R4571:Zfp62 UTSW 11 49215741 missense probably damaging 1.00
R4571:Zfp62 UTSW 11 49215742 missense probably damaging 1.00
R4580:Zfp62 UTSW 11 49216272 missense possibly damaging 0.91
R4631:Zfp62 UTSW 11 49217805 makesense probably null
R5022:Zfp62 UTSW 11 49215729 missense probably damaging 0.96
R5023:Zfp62 UTSW 11 49215729 missense probably damaging 0.96
R5289:Zfp62 UTSW 11 49217148 missense probably damaging 0.98
R5685:Zfp62 UTSW 11 49216217 nonsense probably null
R6420:Zfp62 UTSW 11 49216513 missense probably damaging 1.00
R6764:Zfp62 UTSW 11 49215169 missense probably damaging 0.99
R7000:Zfp62 UTSW 11 49216379 nonsense probably null
R7016:Zfp62 UTSW 11 49215937 missense probably damaging 0.98
R7175:Zfp62 UTSW 11 49216753 missense probably damaging 0.99
R7670:Zfp62 UTSW 11 49215076 start gained probably benign
R7675:Zfp62 UTSW 11 49216020 missense possibly damaging 0.75
R7686:Zfp62 UTSW 11 49217158 missense probably damaging 1.00
R7801:Zfp62 UTSW 11 49217328 missense possibly damaging 0.88
R8190:Zfp62 UTSW 11 49216075 missense probably damaging 1.00
R8390:Zfp62 UTSW 11 49215192 missense probably benign 0.02
X0011:Zfp62 UTSW 11 49215598 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGGAGACTCCATACTGGG -3'
(R):5'- TATAGGACGTCTTGCCAGGG -3'

Sequencing Primer
(F):5'- TCCATACTGGGGAAAAACCATATAAG -3'
(R):5'- GTGATGAAGGCTTTCTCACAC -3'
Posted On2016-08-04