Incidental Mutation 'R5362:Atl2'
ID422899
Institutional Source Beutler Lab
Gene Symbol Atl2
Ensembl Gene ENSMUSG00000059811
Gene Nameatlastin GTPase 2
Synonyms2010110I21Rik, Aip-2, Arl6ip2
MMRRC Submission 043264-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5362 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location79848390-79896123 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79861461 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 37 (N37D)
Ref Sequence ENSEMBL: ENSMUSP00000108056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068282] [ENSMUST00000112437] [ENSMUST00000222193]
Predicted Effect probably damaging
Transcript: ENSMUST00000068282
AA Change: N208D

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000064758
Gene: ENSMUSG00000059811
AA Change: N208D

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
Pfam:GBP 70 341 3.9e-105 PFAM
low complexity region 377 390 N/A INTRINSIC
Blast:HAMP 495 545 4e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112437
AA Change: N37D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108056
Gene: ENSMUSG00000059811
AA Change: N37D

DomainStartEndE-ValueType
Pfam:GBP 1 170 6.6e-69 PFAM
Pfam:GBP_C 172 302 2.7e-8 PFAM
Blast:HAMP 324 374 3e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000222193
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A T 6: 133,294,482 D163V probably benign Het
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd17 G A 5: 90,265,545 A1170V probably damaging Het
Ano1 A C 7: 144,648,600 probably benign Het
C2cd5 T C 6: 143,083,243 Y90C probably damaging Het
Carm1 A G 9: 21,587,359 N499S probably benign Het
Ccdc47 G A 11: 106,208,213 probably null Het
Cd300lf G T 11: 115,117,114 L251M probably damaging Het
Cfap74 A G 4: 155,438,166 S670G probably damaging Het
Clec4a1 A G 6: 122,932,237 D188G probably damaging Het
Col4a1 T C 8: 11,245,760 probably benign Het
Csn2 T A 5: 87,694,649 H165L probably benign Het
Dlx3 T C 11: 95,120,500 V60A possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam221a A G 6: 49,376,115 H21R probably damaging Het
Foxj3 T A 4: 119,620,143 H349Q unknown Het
Gm37240 G A 3: 84,515,693 T123I probably damaging Het
Gpc1 A T 1: 92,854,893 T121S probably benign Het
Ikbkap A C 4: 56,778,969 I616S probably damaging Het
Itga2b A G 11: 102,461,135 V512A probably damaging Het
Itgae A G 11: 73,111,849 Y144C probably damaging Het
Izumo3 A T 4: 92,146,800 I60K possibly damaging Het
Kif9 G A 9: 110,489,944 V159M probably damaging Het
Lrp1b T C 2: 41,375,902 D229G probably damaging Het
Nkpd1 G A 7: 19,523,268 G324D probably damaging Het
Nrp2 T A 1: 62,769,062 Y617N probably benign Het
Ocm T C 5: 144,023,856 D91G probably damaging Het
Olfr600 A G 7: 103,346,247 V227A probably damaging Het
Olfr667 A G 7: 104,916,627 I223T probably damaging Het
Olfr724 A G 14: 49,960,529 L181P possibly damaging Het
Olfr814 T C 10: 129,874,553 E68G probably damaging Het
Pex5l G A 3: 32,992,916 A295V probably damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Pou2f2 G A 7: 25,092,895 P512S probably benign Het
Prpf8 G A 11: 75,506,410 R2023Q possibly damaging Het
Ptprd A T 4: 76,128,813 S399R probably damaging Het
Qrich2 T C 11: 116,447,150 Y1889C probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ranbp6 G T 19: 29,811,728 T408K probably benign Het
Scn7a G A 2: 66,699,998 R668C probably damaging Het
Sertad4 T C 1: 192,847,106 N134S probably damaging Het
Spg11 G T 2: 122,061,000 N1963K probably damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Top2a T C 11: 99,018,912 N120S probably damaging Het
Trappc9 C T 15: 73,058,217 E97K possibly damaging Het
Vmn1r91 A T 7: 20,101,461 T102S probably benign Het
Vmn2r99 G T 17: 19,379,339 M428I probably benign Het
Zfp62 A T 11: 49,216,612 H510L probably damaging Het
Other mutations in Atl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Atl2 APN 17 79859785 critical splice donor site probably null
IGL02692:Atl2 APN 17 79865053 missense probably benign
IGL03127:Atl2 APN 17 79852854 missense probably damaging 0.99
IGL03377:Atl2 APN 17 79865090 missense probably damaging 1.00
R0164:Atl2 UTSW 17 79853831 unclassified probably benign
R1203:Atl2 UTSW 17 79852905 missense probably damaging 0.99
R1489:Atl2 UTSW 17 79852706 missense probably benign 0.00
R1663:Atl2 UTSW 17 79864711 missense probably damaging 1.00
R1977:Atl2 UTSW 17 79852590 missense probably damaging 1.00
R2032:Atl2 UTSW 17 79895944 missense probably benign
R4063:Atl2 UTSW 17 79850159 makesense probably null
R5104:Atl2 UTSW 17 79852617 missense probably benign 0.01
R5201:Atl2 UTSW 17 79865151 missense probably benign
R5387:Atl2 UTSW 17 79852800 missense probably benign 0.03
R6128:Atl2 UTSW 17 79865041 critical splice donor site probably null
R6369:Atl2 UTSW 17 79854555 missense probably damaging 0.96
R6416:Atl2 UTSW 17 79850223 missense probably benign 0.00
R6597:Atl2 UTSW 17 79852766 missense possibly damaging 0.68
R6885:Atl2 UTSW 17 79852553 missense probably damaging 1.00
R7428:Atl2 UTSW 17 79875798 splice site probably null
R7587:Atl2 UTSW 17 79865067 missense probably benign 0.25
R7646:Atl2 UTSW 17 79854607 missense probably damaging 1.00
R7781:Atl2 UTSW 17 79859831 missense probably damaging 1.00
R7949:Atl2 UTSW 17 79859860 missense probably damaging 1.00
R8170:Atl2 UTSW 17 79856261 missense possibly damaging 0.95
R8313:Atl2 UTSW 17 79852604 nonsense probably null
X0052:Atl2 UTSW 17 79852617 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGCATTTCACTGGCTAATAAACTAGG -3'
(R):5'- CACTTGGACCATGAGTATGTATGC -3'

Sequencing Primer
(F):5'- ATGTCCTCTAGTTAGCCAA -3'
(R):5'- GGACCATGAGTATGTATGCTTTATG -3'
Posted On2016-08-04