Incidental Mutation 'R5363:Lactb2'
ID422903
Institutional Source Beutler Lab
Gene Symbol Lactb2
Ensembl Gene ENSMUSG00000025937
Gene Namelactamase, beta 2
SynonymsE430032H21Rik, Cgi-83
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5363 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location13623330-13660546 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13630132 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 225 (I225N)
Ref Sequence ENSEMBL: ENSMUSP00000027071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027071]
Predicted Effect probably benign
Transcript: ENSMUST00000027071
AA Change: I225N

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027071
Gene: ENSMUSG00000025937
AA Change: I225N

DomainStartEndE-ValueType
Lactamase_B 30 199 6.69e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156222
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a null allele exhibit at 40 days of age preceeded by decreased body size, lethargy, enlarged and pale liver and hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Lactb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lactb2 APN 1 13660374 missense probably damaging 1.00
IGL00595:Lactb2 APN 1 13630126 missense probably benign 0.05
IGL00730:Lactb2 APN 1 13647516 splice site probably benign
R0371:Lactb2 UTSW 1 13650760 missense possibly damaging 0.69
R0782:Lactb2 UTSW 1 13647451 missense probably benign 0.18
R1670:Lactb2 UTSW 1 13660417 missense probably damaging 0.99
R2324:Lactb2 UTSW 1 13638296 missense probably damaging 1.00
R2418:Lactb2 UTSW 1 13660339 missense possibly damaging 0.93
R3500:Lactb2 UTSW 1 13660449 start codon destroyed probably null 1.00
R4345:Lactb2 UTSW 1 13660350 missense probably damaging 1.00
R4664:Lactb2 UTSW 1 13647400 missense probably damaging 1.00
R4665:Lactb2 UTSW 1 13647400 missense probably damaging 1.00
R4716:Lactb2 UTSW 1 13638395 missense probably damaging 1.00
R5658:Lactb2 UTSW 1 13627418 missense probably benign 0.03
R5734:Lactb2 UTSW 1 13660387 missense probably damaging 1.00
R5918:Lactb2 UTSW 1 13650730 missense probably benign 0.32
R6419:Lactb2 UTSW 1 13638235 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGATTGCTCTCTGTGGACAC -3'
(R):5'- AGACCTGTGAGCTTTCCAAG -3'

Sequencing Primer
(F):5'- AACTGTTGGTCTCAGGTGTAGACAAC -3'
(R):5'- TTTCCAAGCAATGAATATGTTTGTAC -3'
Posted On2016-08-04