Incidental Mutation 'R5363:Ntmt1'
ID 422907
Institutional Source Beutler Lab
Gene Symbol Ntmt1
Ensembl Gene ENSMUSG00000026857
Gene Name N-terminal Xaa-Pro-Lys N-methyltransferase 1
Synonyms
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.384) question?
Stock # R5363 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 30807826-30823033 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30820648 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 121 (D121G)
Ref Sequence ENSEMBL: ENSMUSP00000035303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041726] [ENSMUST00000041830] [ENSMUST00000127566] [ENSMUST00000128303] [ENSMUST00000129628] [ENSMUST00000129712] [ENSMUST00000138889] [ENSMUST00000152374]
AlphaFold Q8R2U4
Predicted Effect probably benign
Transcript: ENSMUST00000041726
SMART Domains Protein: ENSMUSP00000043462
Gene: ENSMUSG00000039483

DomainStartEndE-ValueType
Blast:ANK 31 63 3e-7 BLAST
ANK 66 95 1.96e3 SMART
ANK 100 129 1.91e-6 SMART
ANK 134 164 1e0 SMART
ANK 168 203 4.3e0 SMART
Blast:ANK 256 287 1e-11 BLAST
SOCS_box 370 410 1.72e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000041830
AA Change: D121G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035303
Gene: ENSMUSG00000026857
AA Change: D121G

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 8 223 2.3e-99 PFAM
Pfam:Ubie_methyltran 36 178 2.8e-7 PFAM
Pfam:Methyltransf_2 59 190 3.6e-8 PFAM
Pfam:Methyltransf_18 61 168 1.5e-9 PFAM
Pfam:Methyltransf_25 65 161 2.4e-8 PFAM
Pfam:Methyltransf_12 66 163 5.2e-11 PFAM
Pfam:Methyltransf_11 66 165 4.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126037
Predicted Effect probably benign
Transcript: ENSMUST00000127566
SMART Domains Protein: ENSMUSP00000142189
Gene: ENSMUSG00000026857

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 8 118 6.7e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128303
SMART Domains Protein: ENSMUSP00000123140
Gene: ENSMUSG00000026857

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 8 78 1.8e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128509
Predicted Effect probably benign
Transcript: ENSMUST00000129628
Predicted Effect probably benign
Transcript: ENSMUST00000129712
SMART Domains Protein: ENSMUSP00000141222
Gene: ENSMUSG00000026857

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 8 42 1.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138889
SMART Domains Protein: ENSMUSP00000141905
Gene: ENSMUSG00000026857

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 8 42 1.7e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000143970
AA Change: D119G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148036
Predicted Effect probably benign
Transcript: ENSMUST00000152374
AA Change: D121G

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116760
Gene: ENSMUSG00000026857
AA Change: D121G

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 8 146 8.7e-65 PFAM
Pfam:Methyltransf_11 66 146 4.7e-7 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The METTL11A gene encodes an N-terminal methyltransferase for the RAN (MIM 601179) guanine nucleotide exchange factor regulator of chromosome condensation 1 (RCC1; MIM 179710). METTL11A enzyme alpha-N-methylates other protein targets such as SET (MIM 600960) and RB (MIM 180200).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality and premature death associated with premature aging, decreased body size and weight, skin thinning, liver degeneration, increased sensitivity to oxidative stress and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Ntmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
puny UTSW 2 30822365 missense probably damaging 1.00
R2265:Ntmt1 UTSW 2 30820460 missense probably benign 0.24
R2266:Ntmt1 UTSW 2 30820460 missense probably benign 0.24
R2267:Ntmt1 UTSW 2 30820460 missense probably benign 0.24
R2858:Ntmt1 UTSW 2 30822365 missense probably damaging 1.00
R2859:Ntmt1 UTSW 2 30822365 missense probably damaging 1.00
R8883:Ntmt1 UTSW 2 30822454 missense probably benign 0.01
R9236:Ntmt1 UTSW 2 30822395 missense probably damaging 1.00
Z1176:Ntmt1 UTSW 2 30822428 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCCTGTGCCTTGGACTG -3'
(R):5'- TAAGATGGCCTCACTAGATAGCTG -3'

Sequencing Primer
(F):5'- CCTTGGACTGTGGCGCTG -3'
(R):5'- GGCCTCACTAGATAGCTGCTATTTAG -3'
Posted On 2016-08-04