Incidental Mutation 'R5363:Ntmt1'
ID 422907
Institutional Source Beutler Lab
Gene Symbol Ntmt1
Ensembl Gene ENSMUSG00000026857
Gene Name N-terminal Xaa-Pro-Lys N-methyltransferase 1
Synonyms Mettl11a, 2610205E22Rik
MMRRC Submission 042941-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.371) question?
Stock # R5363 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 30697838-30713045 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30710660 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 121 (D121G)
Ref Sequence ENSEMBL: ENSMUSP00000035303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041726] [ENSMUST00000041830] [ENSMUST00000127566] [ENSMUST00000128303] [ENSMUST00000129628] [ENSMUST00000129712] [ENSMUST00000138889] [ENSMUST00000152374]
AlphaFold Q8R2U4
Predicted Effect probably benign
Transcript: ENSMUST00000041726
SMART Domains Protein: ENSMUSP00000043462
Gene: ENSMUSG00000039483

DomainStartEndE-ValueType
Blast:ANK 31 63 3e-7 BLAST
ANK 66 95 1.96e3 SMART
ANK 100 129 1.91e-6 SMART
ANK 134 164 1e0 SMART
ANK 168 203 4.3e0 SMART
Blast:ANK 256 287 1e-11 BLAST
SOCS_box 370 410 1.72e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000041830
AA Change: D121G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035303
Gene: ENSMUSG00000026857
AA Change: D121G

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 8 223 2.3e-99 PFAM
Pfam:Ubie_methyltran 36 178 2.8e-7 PFAM
Pfam:Methyltransf_2 59 190 3.6e-8 PFAM
Pfam:Methyltransf_18 61 168 1.5e-9 PFAM
Pfam:Methyltransf_25 65 161 2.4e-8 PFAM
Pfam:Methyltransf_12 66 163 5.2e-11 PFAM
Pfam:Methyltransf_11 66 165 4.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126037
Predicted Effect probably benign
Transcript: ENSMUST00000127566
SMART Domains Protein: ENSMUSP00000142189
Gene: ENSMUSG00000026857

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 8 118 6.7e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128303
SMART Domains Protein: ENSMUSP00000123140
Gene: ENSMUSG00000026857

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 8 78 1.8e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128509
Predicted Effect probably benign
Transcript: ENSMUST00000129628
Predicted Effect probably benign
Transcript: ENSMUST00000129712
SMART Domains Protein: ENSMUSP00000141222
Gene: ENSMUSG00000026857

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 8 42 1.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138889
SMART Domains Protein: ENSMUSP00000141905
Gene: ENSMUSG00000026857

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 8 42 1.7e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000143970
AA Change: D119G
Predicted Effect probably benign
Transcript: ENSMUST00000152374
AA Change: D121G

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116760
Gene: ENSMUSG00000026857
AA Change: D121G

DomainStartEndE-ValueType
Pfam:Methyltransf_PK 8 146 8.7e-65 PFAM
Pfam:Methyltransf_11 66 146 4.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147414
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The METTL11A gene encodes an N-terminal methyltransferase for the RAN (MIM 601179) guanine nucleotide exchange factor regulator of chromosome condensation 1 (RCC1; MIM 179710). METTL11A enzyme alpha-N-methylates other protein targets such as SET (MIM 600960) and RB (MIM 180200).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality and premature death associated with premature aging, decreased body size and weight, skin thinning, liver degeneration, increased sensitivity to oxidative stress and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,132,963 (GRCm39) I40T probably benign Het
Abca13 T C 11: 9,227,035 (GRCm39) V597A possibly damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Anapc1 A G 2: 128,492,114 (GRCm39) probably null Het
Ap4e1 G A 2: 126,879,784 (GRCm39) probably null Het
Apod T C 16: 31,129,909 (GRCm39) T16A probably benign Het
Arrdc5 C T 17: 56,607,138 (GRCm39) V36M probably damaging Het
Bcan A G 3: 87,902,794 (GRCm39) V328A probably damaging Het
Bche A G 3: 73,607,972 (GRCm39) Y485H probably damaging Het
Btbd6 A G 12: 112,941,756 (GRCm39) Y356C probably damaging Het
Cdh4 A G 2: 179,528,556 (GRCm39) T555A probably benign Het
Ciita C T 16: 10,330,031 (GRCm39) H769Y probably damaging Het
Clspn A G 4: 126,455,579 (GRCm39) D35G possibly damaging Het
Cpsf3 T A 12: 21,358,986 (GRCm39) M562K probably benign Het
Cstdc1 G T 2: 148,625,298 (GRCm39) L77F probably damaging Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,759,803 (GRCm39) probably null Het
Cyp2a22 T A 7: 26,635,858 (GRCm39) Q235L probably damaging Het
Dicer1 A G 12: 104,669,410 (GRCm39) S1091P probably damaging Het
Dync1li1 T A 9: 114,544,297 (GRCm39) I323N probably damaging Het
Fat4 A G 3: 38,942,154 (GRCm39) N349S probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Hectd4 T C 5: 121,448,666 (GRCm39) M338T probably benign Het
Insyn2b G A 11: 34,352,788 (GRCm39) E277K probably damaging Het
Lactb2 A T 1: 13,700,356 (GRCm39) I225N probably benign Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Mrps30 A G 13: 118,523,698 (GRCm39) S25P probably benign Het
Myg1 T C 15: 102,246,259 (GRCm39) V378A probably benign Het
Notch4 C T 17: 34,806,097 (GRCm39) T1731I probably damaging Het
Or10p21 C A 10: 128,847,783 (GRCm39) P210T probably damaging Het
Or5d39 A T 2: 87,980,146 (GRCm39) D72E probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pclo A G 5: 14,719,424 (GRCm39) D1187G unknown Het
Pkd1 T A 17: 24,784,047 (GRCm39) Y198N probably benign Het
Plk4 T A 3: 40,756,419 (GRCm39) N83K possibly damaging Het
Prune2 A T 19: 17,095,630 (GRCm39) Q378L probably damaging Het
R3hdm4 C T 10: 79,748,292 (GRCm39) E162K possibly damaging Het
Rasa1 G T 13: 85,436,674 (GRCm39) T118K possibly damaging Het
Rin3 G A 12: 102,292,093 (GRCm39) V97M probably damaging Het
Rock2 T C 12: 17,015,655 (GRCm39) probably null Het
Slc34a1 A G 13: 55,551,081 (GRCm39) I289V probably benign Het
Slc34a1 T C 13: 55,560,103 (GRCm39) L443P probably damaging Het
Slco2a1 A T 9: 102,947,462 (GRCm39) I254F probably damaging Het
Spink11 T C 18: 44,328,753 (GRCm39) I32V probably benign Het
Spire1 T C 18: 67,639,625 (GRCm39) E296G probably damaging Het
Sun1 A G 5: 139,220,498 (GRCm39) N410D probably damaging Het
Syt14 T A 1: 192,612,971 (GRCm39) T610S possibly damaging Het
Tenm3 T C 8: 48,740,866 (GRCm39) I1206V possibly damaging Het
Tet3 A T 6: 83,353,746 (GRCm39) probably null Het
Thbs1 A T 2: 117,953,147 (GRCm39) Q919L probably damaging Het
Trappc10 A G 10: 78,024,674 (GRCm39) F1152L possibly damaging Het
Trp63 C A 16: 25,682,468 (GRCm39) N176K probably damaging Het
Zbtb17 A G 4: 141,194,072 (GRCm39) E700G probably benign Het
Zfp446 G A 7: 12,711,984 (GRCm39) R69H probably benign Het
Zfy2 C T Y: 2,106,555 (GRCm39) C693Y possibly damaging Het
Zxdc A G 6: 90,359,128 (GRCm39) T587A probably damaging Het
Zyg11a A G 4: 108,046,819 (GRCm39) C552R probably damaging Het
Other mutations in Ntmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
puny UTSW 2 30,712,377 (GRCm39) missense probably damaging 1.00
R2265:Ntmt1 UTSW 2 30,710,472 (GRCm39) missense probably benign 0.24
R2266:Ntmt1 UTSW 2 30,710,472 (GRCm39) missense probably benign 0.24
R2267:Ntmt1 UTSW 2 30,710,472 (GRCm39) missense probably benign 0.24
R2858:Ntmt1 UTSW 2 30,712,377 (GRCm39) missense probably damaging 1.00
R2859:Ntmt1 UTSW 2 30,712,377 (GRCm39) missense probably damaging 1.00
R8883:Ntmt1 UTSW 2 30,712,466 (GRCm39) missense probably benign 0.01
R9236:Ntmt1 UTSW 2 30,712,407 (GRCm39) missense probably damaging 1.00
Z1176:Ntmt1 UTSW 2 30,712,440 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCCTGTGCCTTGGACTG -3'
(R):5'- TAAGATGGCCTCACTAGATAGCTG -3'

Sequencing Primer
(F):5'- CCTTGGACTGTGGCGCTG -3'
(R):5'- GGCCTCACTAGATAGCTGCTATTTAG -3'
Posted On 2016-08-04