Incidental Mutation 'R5363:Cwc22'
ID 422908
Institutional Source Beutler Lab
Gene Symbol Cwc22
Ensembl Gene ENSMUSG00000027014
Gene Name CWC22 spliceosome-associated protein
Synonyms
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5363 (G1)
Quality Score 107
Status Not validated
Chromosome 2
Chromosomal Location 77881159-77946375 bp(-) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) ATCTCTCTCTCTCTCTCT to ATCTCTCTCTCTCTCT at 77929459 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065889] [ENSMUST00000111818] [ENSMUST00000111819] [ENSMUST00000111821] [ENSMUST00000111824] [ENSMUST00000127289] [ENSMUST00000128963]
AlphaFold Q8C5N3
Predicted Effect probably null
Transcript: ENSMUST00000065889
SMART Domains Protein: ENSMUSP00000064947
Gene: ENSMUSG00000027014

DomainStartEndE-ValueType
low complexity region 37 98 N/A INTRINSIC
MIF4G 161 344 1e-33 SMART
low complexity region 421 438 N/A INTRINSIC
MA3 454 560 4.45e-26 SMART
low complexity region 669 712 N/A INTRINSIC
low complexity region 746 777 N/A INTRINSIC
low complexity region 847 862 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111818
SMART Domains Protein: ENSMUSP00000107449
Gene: ENSMUSG00000027014

DomainStartEndE-ValueType
low complexity region 37 98 N/A INTRINSIC
MIF4G 161 344 1e-33 SMART
low complexity region 421 438 N/A INTRINSIC
MA3 454 560 4.45e-26 SMART
low complexity region 668 713 N/A INTRINSIC
low complexity region 740 771 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111819
SMART Domains Protein: ENSMUSP00000107450
Gene: ENSMUSG00000027014

DomainStartEndE-ValueType
low complexity region 38 99 N/A INTRINSIC
MIF4G 162 345 1e-33 SMART
low complexity region 422 439 N/A INTRINSIC
MA3 455 561 4.45e-26 SMART
low complexity region 669 714 N/A INTRINSIC
low complexity region 741 772 N/A INTRINSIC
low complexity region 842 857 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111821
SMART Domains Protein: ENSMUSP00000107452
Gene: ENSMUSG00000027014

DomainStartEndE-ValueType
low complexity region 37 98 N/A INTRINSIC
MIF4G 161 344 1e-33 SMART
low complexity region 421 438 N/A INTRINSIC
MA3 454 560 4.45e-26 SMART
low complexity region 669 712 N/A INTRINSIC
low complexity region 746 777 N/A INTRINSIC
low complexity region 847 862 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111824
SMART Domains Protein: ENSMUSP00000107455
Gene: ENSMUSG00000027014

DomainStartEndE-ValueType
low complexity region 37 98 N/A INTRINSIC
MIF4G 161 344 1e-33 SMART
low complexity region 421 438 N/A INTRINSIC
MA3 454 560 4.45e-26 SMART
low complexity region 669 715 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127289
SMART Domains Protein: ENSMUSP00000122338
Gene: ENSMUSG00000027014

DomainStartEndE-ValueType
low complexity region 38 99 N/A INTRINSIC
PDB:4C9B|B 115 139 2e-9 PDB
Blast:MIF4G 118 139 1e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127351
Predicted Effect probably null
Transcript: ENSMUST00000128963
SMART Domains Protein: ENSMUSP00000115067
Gene: ENSMUSG00000027014

DomainStartEndE-ValueType
low complexity region 37 98 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156863
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Cwc22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Cwc22 APN 2 77917064 missense probably benign 0.00
IGL01739:Cwc22 APN 2 77927296 missense probably damaging 1.00
IGL01754:Cwc22 APN 2 77924539 missense probably damaging 0.99
IGL02011:Cwc22 APN 2 77921022 missense possibly damaging 0.88
R0115:Cwc22 UTSW 2 77908111 missense probably damaging 1.00
R0271:Cwc22 UTSW 2 77920858 missense probably benign 0.19
R0481:Cwc22 UTSW 2 77908111 missense probably damaging 1.00
R1086:Cwc22 UTSW 2 77924480 unclassified probably benign
R1165:Cwc22 UTSW 2 77903898 missense probably damaging 0.98
R1394:Cwc22 UTSW 2 77929479 missense possibly damaging 0.91
R1445:Cwc22 UTSW 2 77917177 splice site probably benign
R1448:Cwc22 UTSW 2 77911555 missense probably damaging 1.00
R1640:Cwc22 UTSW 2 77915530 missense possibly damaging 0.82
R1800:Cwc22 UTSW 2 77929453 missense possibly damaging 0.70
R1822:Cwc22 UTSW 2 77924659 unclassified probably benign
R1916:Cwc22 UTSW 2 77905475 missense probably benign 0.28
R2225:Cwc22 UTSW 2 77908151 splice site probably benign
R2360:Cwc22 UTSW 2 77927247 missense probably damaging 1.00
R3113:Cwc22 UTSW 2 77924479 unclassified probably benign
R4962:Cwc22 UTSW 2 77896309 missense probably benign 0.00
R5394:Cwc22 UTSW 2 77929339 missense possibly damaging 0.67
R5467:Cwc22 UTSW 2 77929459 frame shift probably null
R5531:Cwc22 UTSW 2 77924569 missense probably damaging 0.99
R5677:Cwc22 UTSW 2 77929443 missense probably damaging 0.97
R6148:Cwc22 UTSW 2 77929459 frame shift probably null
R6263:Cwc22 UTSW 2 77896171 missense possibly damaging 0.93
R6860:Cwc22 UTSW 2 77929448 missense possibly damaging 0.53
R7133:Cwc22 UTSW 2 77929478 missense possibly damaging 0.91
R7571:Cwc22 UTSW 2 77917067 missense probably benign
R8168:Cwc22 UTSW 2 77927271 missense probably damaging 1.00
R8709:Cwc22 UTSW 2 77896350 missense probably benign 0.22
R8758:Cwc22 UTSW 2 77917097 missense possibly damaging 0.81
R8954:Cwc22 UTSW 2 77924593 missense probably damaging 0.97
R9129:Cwc22 UTSW 2 77896315 nonsense probably null
R9266:Cwc22 UTSW 2 77924608 missense probably benign 0.03
R9273:Cwc22 UTSW 2 77929459 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TTGCTCTGGAGGTGCAGTAC -3'
(R):5'- GGTACCCTCTCTGTGAGTATTG -3'

Sequencing Primer
(F):5'- TGCAGTACATCAGCGTACCTG -3'
(R):5'- GTGAGTATTGCTTCACCATCCTGAAC -3'
Posted On 2016-08-04