Incidental Mutation 'R5363:Olfr1167'
ID422909
Institutional Source Beutler Lab
Gene Symbol Olfr1167
Ensembl Gene ENSMUSG00000100899
Gene Nameolfactory receptor 1167
SynonymsMOR174-16, GA_x6K02T2Q125-49641892-49640942
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5363 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88146150-88155193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88149802 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 72 (D72E)
Ref Sequence ENSEMBL: ENSMUSP00000149599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099832] [ENSMUST00000216951]
Predicted Effect probably damaging
Transcript: ENSMUST00000099832
AA Change: D72E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097420
Gene: ENSMUSG00000100899
AA Change: D72E

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.3e-47 PFAM
Pfam:7tm_1 43 292 3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216951
AA Change: D72E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Olfr1167
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Olfr1167 APN 2 88149260 missense possibly damaging 0.55
IGL01525:Olfr1167 APN 2 88149877 missense probably benign 0.15
IGL02008:Olfr1167 APN 2 88149578 missense probably damaging 1.00
IGL02116:Olfr1167 APN 2 88149288 missense probably benign 0.03
IGL02740:Olfr1167 APN 2 88149257 missense probably damaging 1.00
IGL03493:Olfr1167 APN 2 88149936 missense probably benign 0.02
PIT4498001:Olfr1167 UTSW 2 88149915 missense probably benign 0.00
R1951:Olfr1167 UTSW 2 88149297 missense possibly damaging 0.50
R2060:Olfr1167 UTSW 2 88149143 missense probably damaging 1.00
R4167:Olfr1167 UTSW 2 88149845 missense probably damaging 0.97
R4168:Olfr1167 UTSW 2 88149845 missense probably damaging 0.97
R4244:Olfr1167 UTSW 2 88149288 missense probably benign 0.00
R5778:Olfr1167 UTSW 2 88149617 missense probably damaging 1.00
R5939:Olfr1167 UTSW 2 88149509 missense probably damaging 1.00
R6502:Olfr1167 UTSW 2 88150016 start codon destroyed probably null 0.37
R7036:Olfr1167 UTSW 2 88149125 missense probably damaging 0.99
R7104:Olfr1167 UTSW 2 88149372 missense possibly damaging 0.65
R7340:Olfr1167 UTSW 2 88149276 missense possibly damaging 0.95
R7481:Olfr1167 UTSW 2 88149761 missense probably benign 0.12
R7615:Olfr1167 UTSW 2 88149518 missense probably benign 0.01
X0050:Olfr1167 UTSW 2 88149696 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTACTAGCAGAGCACAGAATTG -3'
(R):5'- TCTTGGTCGGTTTCTCAGAATATC -3'

Sequencing Primer
(F):5'- GAGCACAGAATTGTATAGGCATTAC -3'
(R):5'- GGTCGGTTTCTCAGAATATCCACAG -3'
Posted On2016-08-04