Mutagenetix > Incidental Mutations

Incidental Mutation 'R5363:Thbs1'

422910

Institutional Source

Beutler Lab

Gene Symbol

Thbs1

Ensembl Gene

ENSMUSG00000040152

Gene Name

thrombospondin 1

Synonyms

TSP-1, TSP1, tbsp1, Thbs-1

MMRRC Submission

042941-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5363 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118111876-118127133 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 118122666 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 919 (Q919L)

Ref Sequence

ENSEMBL: ENSMUSP00000044903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039559]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000039559
AA Change: Q919L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044903
Gene: ENSMUSG00000040152
AA Change: Q919L

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
TSPN	24	221	2.68e-60	SMART
low complexity region	237	249	N/A	INTRINSIC
coiled coil region	292	315	N/A	INTRINSIC
VWC	319	373	3.6e-20	SMART
TSP1	383	430	4.21e-12	SMART
TSP1	439	491	3.04e-18	SMART
TSP1	496	548	8.6e-18	SMART
EGF	551	588	3.88e-3	SMART
EGF	592	646	1.69e1	SMART
EGF	650	691	7.13e-2	SMART
Pfam:TSP_3	728	763	5.8e-12	PFAM
Pfam:TSP_3	763	786	2.1e-5	PFAM
Pfam:TSP_3	787	822	3.3e-13	PFAM
Pfam:TSP_3	822	845	1.1e-6	PFAM
Pfam:TSP_3	846	883	2e-15	PFAM
Pfam:TSP_3	884	919	8.3e-13	PFAM
Pfam:TSP_3	920	954	4.9e-10	PFAM
Pfam:TSP_C	973	1170	1.4e-99	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142588

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190311

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a subunit of a disulfide-linked homotrimeric protein. This protein is an adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein can bind to fibrinogen, fibronectin, laminin, type V collagen and integrins alpha-V/beta-1. This protein has been shown to play roles in platelet aggregation, angiogenesis, and tumorigenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice show partial prenatal lethality, lordosis, kyphosis, leukocytosis, multiorgan inflammation, lung hemorrhage, pneumonia, resistance to radiation and ischemic injury, altered blood pressure and vasoactive stress responses, eye pathology, and corneal and lacrimal gland dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Abca1	A	G	4: 53,132,963	I40T	probably benign	Het
Abca13	T	C	11: 9,277,035	V597A	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc1	A	G	2: 128,650,194		probably null	Het
Ap4e1	G	A	2: 127,037,864		probably null	Het
Apod	T	C	16: 31,311,091	T16A	probably benign	Het
Arrdc5	C	T	17: 56,300,138	V36M	probably damaging	Het
Bcan	A	G	3: 87,995,487	V328A	probably damaging	Het
Bche	A	G	3: 73,700,639	Y485H	probably damaging	Het
Btbd6	A	G	12: 112,978,136	Y356C	probably damaging	Het
Cdh4	A	G	2: 179,886,763	T555A	probably benign	Het
Ciita	C	T	16: 10,512,167	H769Y	probably damaging	Het
Clspn	A	G	4: 126,561,786	D35G	possibly damaging	Het
Cpsf3	T	A	12: 21,308,985	M562K	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cyp2a22	T	A	7: 26,936,433	Q235L	probably damaging	Het
Dicer1	A	G	12: 104,703,151	S1091P	probably damaging	Het
Dync1li1	T	A	9: 114,715,229	I323N	probably damaging	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat4	A	G	3: 38,888,005	N349S	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Hectd4	T	C	5: 121,310,603	M338T	probably benign	Het
Lactb2	A	T	1: 13,630,132	I225N	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mrps30	A	G	13: 118,387,162	S25P	probably benign	Het
Myg1	T	C	15: 102,337,824	V378A	probably benign	Het
Notch4	C	T	17: 34,587,123	T1731I	probably damaging	Het
Ntmt1	A	G	2: 30,820,648	D121G	probably damaging	Het
Olfr1167	A	T	2: 88,149,802	D72E	probably damaging	Het
Olfr763	C	A	10: 129,011,914	P210T	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pclo	A	G	5: 14,669,410	D1187G	unknown	Het
Pkd1	T	A	17: 24,565,073	Y198N	probably benign	Het
Plk4	T	A	3: 40,801,984	N83K	possibly damaging	Het
Prune2	A	T	19: 17,118,266	Q378L	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rasa1	G	T	13: 85,288,555	T118K	possibly damaging	Het
Rin3	G	A	12: 102,325,834	V97M	probably damaging	Het
Rock2	T	C	12: 16,965,654		probably null	Het
Slc34a1	A	G	13: 55,403,268	I289V	probably benign	Het
Slc34a1	T	C	13: 55,412,290	L443P	probably damaging	Het
Slco2a1	A	T	9: 103,070,263	I254F	probably damaging	Het
Spink11	T	C	18: 44,195,686	I32V	probably benign	Het
Spire1	T	C	18: 67,506,555	E296G	probably damaging	Het
Sun1	A	G	5: 139,234,743	N410D	probably damaging	Het
Syt14	T	A	1: 192,930,663	T610S	possibly damaging	Het
Tenm3	T	C	8: 48,287,831	I1206V	possibly damaging	Het
Tet3	A	T	6: 83,376,764		probably null	Het
Trappc10	A	G	10: 78,188,840	F1152L	possibly damaging	Het
Trp63	C	A	16: 25,863,718	N176K	probably damaging	Het
Zbtb17	A	G	4: 141,466,761	E700G	probably benign	Het
Zfp446	G	A	7: 12,978,057	R69H	probably benign	Het
Zfy2	C	T	Y: 2,106,555	C693Y	possibly damaging	Het
Zxdc	A	G	6: 90,382,146	T587A	probably damaging	Het
Zyg11a	A	G	4: 108,189,622	C552R	probably damaging	Het

Other mutations in Thbs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00801:Thbs1	APN	2	118122973	missense	probably damaging	1.00
IGL00920:Thbs1	APN	2	118113201	missense	probably damaging	0.99
IGL01295:Thbs1	APN	2	118118327	missense	possibly damaging	0.88
IGL01649:Thbs1	APN	2	118114982	missense	probably benign
IGL02077:Thbs1	APN	2	118113110	missense	probably benign	0.00
IGL02251:Thbs1	APN	2	118113518	missense	probably benign	0.00
IGL02263:Thbs1	APN	2	118119880	missense	probably benign	0.06
IGL02392:Thbs1	APN	2	118114660	missense	probably benign
IGL02393:Thbs1	APN	2	118123099	missense	possibly damaging	0.87
IGL02411:Thbs1	APN	2	118114970	missense	probably benign
IGL02659:Thbs1	APN	2	118114792	missense	probably benign	0.29
Stark	UTSW	2	118121237	critical splice donor site	probably null
R0014:Thbs1	UTSW	2	118113350	missense	possibly damaging	0.51
R0042:Thbs1	UTSW	2	118122877	missense	probably damaging	1.00
R0064:Thbs1	UTSW	2	118123914	critical splice acceptor site	probably null
R0240:Thbs1	UTSW	2	118114393	missense	probably damaging	1.00
R0240:Thbs1	UTSW	2	118114393	missense	probably damaging	1.00
R0316:Thbs1	UTSW	2	118117574	missense	probably damaging	1.00
R0393:Thbs1	UTSW	2	118112991	missense	possibly damaging	0.69
R0678:Thbs1	UTSW	2	118122906	missense	probably damaging	1.00
R1037:Thbs1	UTSW	2	118123051	missense	probably damaging	1.00
R1440:Thbs1	UTSW	2	118114355	missense	probably damaging	1.00
R1454:Thbs1	UTSW	2	118122672	missense	probably damaging	1.00
R1571:Thbs1	UTSW	2	118119197	missense	probably damaging	0.99
R1702:Thbs1	UTSW	2	118113442	missense	probably benign
R2035:Thbs1	UTSW	2	118118340	critical splice donor site	probably null
R2068:Thbs1	UTSW	2	118123537	nonsense	probably null
R2171:Thbs1	UTSW	2	118122579	missense	probably damaging	1.00
R2844:Thbs1	UTSW	2	118117628	missense	probably benign	0.00
R2870:Thbs1	UTSW	2	118119378	missense	probably damaging	1.00
R2870:Thbs1	UTSW	2	118119378	missense	probably damaging	1.00
R3620:Thbs1	UTSW	2	118121159	missense	probably benign	0.05
R3621:Thbs1	UTSW	2	118121159	missense	probably benign	0.05
R3726:Thbs1	UTSW	2	118114710	missense	probably benign	0.02
R4499:Thbs1	UTSW	2	118119950	missense	possibly damaging	0.82
R4524:Thbs1	UTSW	2	118122979	missense	probably damaging	1.00
R4576:Thbs1	UTSW	2	118119416	missense	probably damaging	0.97
R4596:Thbs1	UTSW	2	118114755	missense	possibly damaging	0.80
R4646:Thbs1	UTSW	2	118118329	missense	probably benign	0.15
R4783:Thbs1	UTSW	2	118114792	missense	probably benign	0.04
R4836:Thbs1	UTSW	2	118115018	missense	possibly damaging	0.91
R4943:Thbs1	UTSW	2	118113449	missense	probably damaging	1.00
R4967:Thbs1	UTSW	2	118114778	missense	probably benign
R5014:Thbs1	UTSW	2	118120037	critical splice donor site	probably null
R5062:Thbs1	UTSW	2	118121237	critical splice donor site	probably null
R5420:Thbs1	UTSW	2	118113155	missense	possibly damaging	0.83
R5432:Thbs1	UTSW	2	118114683	missense	probably benign	0.25
R5788:Thbs1	UTSW	2	118122508	missense	probably damaging	1.00
R6221:Thbs1	UTSW	2	118119997	missense	probably damaging	1.00
R6327:Thbs1	UTSW	2	118112656	missense	unknown
R6466:Thbs1	UTSW	2	118119847	missense	probably damaging	1.00
R6480:Thbs1	UTSW	2	118119117	missense	probably damaging	1.00
R6794:Thbs1	UTSW	2	118120038	splice site	probably null
R6983:Thbs1	UTSW	2	118119952	missense	probably damaging	1.00
R7284:Thbs1	UTSW	2	118119356	missense	probably damaging	1.00
R7320:Thbs1	UTSW	2	118114957	missense	possibly damaging	0.80
R7467:Thbs1	UTSW	2	118118200	missense	probably damaging	1.00
R7542:Thbs1	UTSW	2	118121174	missense	probably damaging	1.00
R7552:Thbs1	UTSW	2	118113362	missense	possibly damaging	0.90
R7575:Thbs1	UTSW	2	118122928	missense	probably damaging	1.00
R7870:Thbs1	UTSW	2	118115027	missense	possibly damaging	0.46
R7943:Thbs1	UTSW	2	118119617	splice site	probably null
R8267:Thbs1	UTSW	2	118122513	missense	probably damaging	1.00
R8402:Thbs1	UTSW	2	118115878	missense	possibly damaging	0.88
R8672:Thbs1	UTSW	2	118113238	missense	probably benign
R8726:Thbs1	UTSW	2	118119476	critical splice donor site	probably null
R8784:Thbs1	UTSW	2	118113132	missense	probably damaging	0.99
R9010:Thbs1	UTSW	2	118122564	missense	probably damaging	1.00
R9353:Thbs1	UTSW	2	118122570	missense	probably damaging	1.00
R9416:Thbs1	UTSW	2	118117502	missense	probably benign	0.11
RF039:Thbs1	UTSW	2	118122865	critical splice acceptor site	probably benign
RF054:Thbs1	UTSW	2	118122865	critical splice acceptor site	probably benign
X0019:Thbs1	UTSW	2	118112982	missense	probably damaging	1.00
Z1176:Thbs1	UTSW	2	118113479	missense	probably benign	0.34
Z1176:Thbs1	UTSW	2	118120977	missense	probably benign	0.25
Z1176:Thbs1	UTSW	2	118122922	missense	probably damaging	1.00
Z1177:Thbs1	UTSW	2	118117658	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTGACAACAATCAGGACATCG -3'
(R):5'- GGCCATCACCTAAGGTCAAAGG -3'

Sequencing Primer
(F):5'- CATCGATGAGGATGGCCATC -3'
(R):5'- TCACCTAAGGTCAAAGGTCAAAG -3'

Posted On

2016-08-04