Incidental Mutation 'R5363:Ap4e1'
ID422911
Institutional Source Beutler Lab
Gene Symbol Ap4e1
Ensembl Gene ENSMUSG00000001998
Gene Nameadaptor-related protein complex AP-4, epsilon 1
Synonyms2310033A20Rik
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R5363 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location127008717-127067909 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 127037864 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002063] [ENSMUST00000110394] [ENSMUST00000175663] [ENSMUST00000177372]
Predicted Effect probably null
Transcript: ENSMUST00000002063
SMART Domains Protein: ENSMUSP00000002063
Gene: ENSMUSG00000001998

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 600 5.9e-90 PFAM
low complexity region 841 853 N/A INTRINSIC
AP4E_app_platf 1017 1120 4.2e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110394
SMART Domains Protein: ENSMUSP00000106024
Gene: ENSMUSG00000001998

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 392 2.4e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175177
Predicted Effect probably benign
Transcript: ENSMUST00000175663
SMART Domains Protein: ENSMUSP00000135599
Gene: ENSMUSG00000001998

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 355 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177372
SMART Domains Protein: ENSMUSP00000135449
Gene: ENSMUSG00000001998

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 291 2.5e-47 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adaptor complexes large subunit protein family. These proteins are components of the heterotetrameric adaptor protein complexes, which play important roles in the secretory and endocytic pathways by mediating vesicle formation and sorting of integral membrane proteins. The encoded protein is a large subunit of adaptor protein complex-4, which is associated with both clathrin- and nonclathrin-coated vesicles. Disruption of this gene may be associated with cerebral palsy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enlarged lateral ventricles, decreased corpus callosum size, decreased vertical activity, and female anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Ap4e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ap4e1 APN 2 127028281 missense probably damaging 1.00
IGL00423:Ap4e1 APN 2 127028289 missense probably damaging 0.99
IGL00659:Ap4e1 APN 2 127063301 missense probably benign 0.30
IGL01155:Ap4e1 APN 2 127043445 missense probably damaging 1.00
IGL01672:Ap4e1 APN 2 127052189 missense probably damaging 1.00
IGL01866:Ap4e1 APN 2 127046910 missense possibly damaging 0.83
IGL01940:Ap4e1 APN 2 127043511 missense probably damaging 0.97
IGL02131:Ap4e1 APN 2 127061929 missense probably benign
IGL02207:Ap4e1 APN 2 127011816 missense probably damaging 1.00
IGL03394:Ap4e1 APN 2 127063397 missense probably benign 0.18
quickstep UTSW 2 127008902 critical splice donor site probably null
K7371:Ap4e1 UTSW 2 127066536 unclassified probably benign
R0090:Ap4e1 UTSW 2 127064985 missense possibly damaging 0.70
R0420:Ap4e1 UTSW 2 127049360 missense probably damaging 1.00
R0490:Ap4e1 UTSW 2 127046186 missense probably damaging 1.00
R0632:Ap4e1 UTSW 2 127049280 nonsense probably null
R0670:Ap4e1 UTSW 2 127011864 critical splice donor site probably null
R0698:Ap4e1 UTSW 2 127063363 missense probably benign 0.00
R1183:Ap4e1 UTSW 2 127014201 missense probably damaging 0.98
R1338:Ap4e1 UTSW 2 127046909 missense probably damaging 1.00
R1513:Ap4e1 UTSW 2 127061555 missense probably null 1.00
R1528:Ap4e1 UTSW 2 127011823 missense possibly damaging 0.50
R1994:Ap4e1 UTSW 2 127061547 missense probably benign 0.00
R2270:Ap4e1 UTSW 2 127047163 critical splice donor site probably null
R2271:Ap4e1 UTSW 2 127047163 critical splice donor site probably null
R3108:Ap4e1 UTSW 2 127056306 critical splice donor site probably null
R4019:Ap4e1 UTSW 2 127061926 missense probably benign 0.01
R4020:Ap4e1 UTSW 2 127061926 missense probably benign 0.01
R4454:Ap4e1 UTSW 2 127047141 missense probably damaging 1.00
R4691:Ap4e1 UTSW 2 127061871 missense probably benign 0.08
R4767:Ap4e1 UTSW 2 127060438 missense probably benign
R4803:Ap4e1 UTSW 2 127049559 missense probably benign 0.20
R4804:Ap4e1 UTSW 2 127043758 critical splice donor site probably null
R5155:Ap4e1 UTSW 2 127063369 missense probably benign 0.02
R5157:Ap4e1 UTSW 2 127061695 missense probably benign 0.00
R5248:Ap4e1 UTSW 2 127064922 missense possibly damaging 0.95
R5507:Ap4e1 UTSW 2 127008898 missense probably damaging 0.98
R5642:Ap4e1 UTSW 2 127064979 missense possibly damaging 0.67
R6122:Ap4e1 UTSW 2 127028160 splice site probably null
R6180:Ap4e1 UTSW 2 127066588 nonsense probably null
R6298:Ap4e1 UTSW 2 127047115 missense probably benign 0.00
R6329:Ap4e1 UTSW 2 127061716 missense probably benign 0.10
R6543:Ap4e1 UTSW 2 127066605 missense probably benign 0.03
R6954:Ap4e1 UTSW 2 127064951 missense probably benign 0.01
R7144:Ap4e1 UTSW 2 127011807 missense probably damaging 0.99
R7165:Ap4e1 UTSW 2 127063318 missense possibly damaging 0.48
R7348:Ap4e1 UTSW 2 127061976 missense probably damaging 0.96
R7348:Ap4e1 UTSW 2 127061977 missense possibly damaging 0.76
R7382:Ap4e1 UTSW 2 127008902 critical splice donor site probably null
R7571:Ap4e1 UTSW 2 127019336 missense probably damaging 1.00
R7768:Ap4e1 UTSW 2 127046934 missense probably damaging 1.00
X0060:Ap4e1 UTSW 2 127063410 missense probably benign 0.01
X0065:Ap4e1 UTSW 2 127061650 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGGCTGAGTAGTCCCTTTG -3'
(R):5'- GACTTGCATATCTATACTCATGCACAC -3'

Sequencing Primer
(F):5'- TAGTCCCTTTGGTAAAGTAGGAAG -3'
(R):5'- ATATCTATACTCATGCACACAAAGTC -3'
Posted On2016-08-04