Mutagenetix > Incidental Mutations

Incidental Mutation 'R5363:Ap4e1'

422911

Institutional Source

Beutler Lab

Gene Symbol

Ap4e1

Ensembl Gene

ENSMUSG00000001998

Gene Name

adaptor-related protein complex AP-4, epsilon 1

Synonyms

2310033A20Rik

MMRRC Submission

042941-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R5363 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

127008717-127067909 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 127037864 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000106024 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002063] [ENSMUST00000110394] [ENSMUST00000175663] [ENSMUST00000177372]

AlphaFold

Q80V94

Predicted Effect

probably null
Transcript: ENSMUST00000002063

SMART Domains

Protein: ENSMUSP00000002063
Gene: ENSMUSG00000001998

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	51	600	5.9e-90	PFAM
low complexity region	841	853	N/A	INTRINSIC
AP4E_app_platf	1017	1120	4.2e-51	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000110394

SMART Domains

Protein: ENSMUSP00000106024
Gene: ENSMUSG00000001998

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	51	392	2.4e-66	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149254

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175177

Predicted Effect

probably benign
Transcript: ENSMUST00000175663

SMART Domains

Protein: ENSMUSP00000135599
Gene: ENSMUSG00000001998

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	51	355	1.3e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177372

SMART Domains

Protein: ENSMUSP00000135449
Gene: ENSMUSG00000001998

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	51	291	2.5e-47	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adaptor complexes large subunit protein family. These proteins are components of the heterotetrameric adaptor protein complexes, which play important roles in the secretory and endocytic pathways by mediating vesicle formation and sorting of integral membrane proteins. The encoded protein is a large subunit of adaptor protein complex-4, which is associated with both clathrin- and nonclathrin-coated vesicles. Disruption of this gene may be associated with cerebral palsy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enlarged lateral ventricles, decreased corpus callosum size, decreased vertical activity, and female anemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Abca1	A	G	4: 53,132,963	I40T	probably benign	Het
Abca13	T	C	11: 9,277,035	V597A	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc1	A	G	2: 128,650,194		probably null	Het
Apod	T	C	16: 31,311,091	T16A	probably benign	Het
Arrdc5	C	T	17: 56,300,138	V36M	probably damaging	Het
Bcan	A	G	3: 87,995,487	V328A	probably damaging	Het
Bche	A	G	3: 73,700,639	Y485H	probably damaging	Het
Btbd6	A	G	12: 112,978,136	Y356C	probably damaging	Het
Cdh4	A	G	2: 179,886,763	T555A	probably benign	Het
Ciita	C	T	16: 10,512,167	H769Y	probably damaging	Het
Clspn	A	G	4: 126,561,786	D35G	possibly damaging	Het
Cpsf3	T	A	12: 21,308,985	M562K	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cyp2a22	T	A	7: 26,936,433	Q235L	probably damaging	Het
Dicer1	A	G	12: 104,703,151	S1091P	probably damaging	Het
Dync1li1	T	A	9: 114,715,229	I323N	probably damaging	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat4	A	G	3: 38,888,005	N349S	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Hectd4	T	C	5: 121,310,603	M338T	probably benign	Het
Lactb2	A	T	1: 13,630,132	I225N	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mrps30	A	G	13: 118,387,162	S25P	probably benign	Het
Myg1	T	C	15: 102,337,824	V378A	probably benign	Het
Notch4	C	T	17: 34,587,123	T1731I	probably damaging	Het
Ntmt1	A	G	2: 30,820,648	D121G	probably damaging	Het
Olfr1167	A	T	2: 88,149,802	D72E	probably damaging	Het
Olfr763	C	A	10: 129,011,914	P210T	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pclo	A	G	5: 14,669,410	D1187G	unknown	Het
Pkd1	T	A	17: 24,565,073	Y198N	probably benign	Het
Plk4	T	A	3: 40,801,984	N83K	possibly damaging	Het
Prune2	A	T	19: 17,118,266	Q378L	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rasa1	G	T	13: 85,288,555	T118K	possibly damaging	Het
Rin3	G	A	12: 102,325,834	V97M	probably damaging	Het
Rock2	T	C	12: 16,965,654		probably null	Het
Slc34a1	A	G	13: 55,403,268	I289V	probably benign	Het
Slc34a1	T	C	13: 55,412,290	L443P	probably damaging	Het
Slco2a1	A	T	9: 103,070,263	I254F	probably damaging	Het
Spink11	T	C	18: 44,195,686	I32V	probably benign	Het
Spire1	T	C	18: 67,506,555	E296G	probably damaging	Het
Sun1	A	G	5: 139,234,743	N410D	probably damaging	Het
Syt14	T	A	1: 192,930,663	T610S	possibly damaging	Het
Tenm3	T	C	8: 48,287,831	I1206V	possibly damaging	Het
Tet3	A	T	6: 83,376,764		probably null	Het
Thbs1	A	T	2: 118,122,666	Q919L	probably damaging	Het
Trappc10	A	G	10: 78,188,840	F1152L	possibly damaging	Het
Trp63	C	A	16: 25,863,718	N176K	probably damaging	Het
Zbtb17	A	G	4: 141,466,761	E700G	probably benign	Het
Zfp446	G	A	7: 12,978,057	R69H	probably benign	Het
Zfy2	C	T	Y: 2,106,555	C693Y	possibly damaging	Het
Zxdc	A	G	6: 90,382,146	T587A	probably damaging	Het
Zyg11a	A	G	4: 108,189,622	C552R	probably damaging	Het

Other mutations in Ap4e1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Ap4e1	APN	2	127028281	missense	probably damaging	1.00
IGL00423:Ap4e1	APN	2	127028289	missense	probably damaging	0.99
IGL00659:Ap4e1	APN	2	127063301	missense	probably benign	0.30
IGL01155:Ap4e1	APN	2	127043445	missense	probably damaging	1.00
IGL01672:Ap4e1	APN	2	127052189	missense	probably damaging	1.00
IGL01866:Ap4e1	APN	2	127046910	missense	possibly damaging	0.83
IGL01940:Ap4e1	APN	2	127043511	missense	probably damaging	0.97
IGL02131:Ap4e1	APN	2	127061929	missense	probably benign
IGL02207:Ap4e1	APN	2	127011816	missense	probably damaging	1.00
IGL03394:Ap4e1	APN	2	127063397	missense	probably benign	0.18
quickstep	UTSW	2	127008902	critical splice donor site	probably null
K7371:Ap4e1	UTSW	2	127066536	unclassified	probably benign
R0090:Ap4e1	UTSW	2	127064985	missense	possibly damaging	0.70
R0420:Ap4e1	UTSW	2	127049360	missense	probably damaging	1.00
R0490:Ap4e1	UTSW	2	127046186	missense	probably damaging	1.00
R0632:Ap4e1	UTSW	2	127049280	nonsense	probably null
R0670:Ap4e1	UTSW	2	127011864	critical splice donor site	probably null
R0698:Ap4e1	UTSW	2	127063363	missense	probably benign	0.00
R1183:Ap4e1	UTSW	2	127014201	missense	probably damaging	0.98
R1338:Ap4e1	UTSW	2	127046909	missense	probably damaging	1.00
R1513:Ap4e1	UTSW	2	127061555	missense	probably null	1.00
R1528:Ap4e1	UTSW	2	127011823	missense	possibly damaging	0.50
R1994:Ap4e1	UTSW	2	127061547	missense	probably benign	0.00
R2270:Ap4e1	UTSW	2	127047163	critical splice donor site	probably null
R2271:Ap4e1	UTSW	2	127047163	critical splice donor site	probably null
R3108:Ap4e1	UTSW	2	127056306	critical splice donor site	probably null
R4019:Ap4e1	UTSW	2	127061926	missense	probably benign	0.01
R4020:Ap4e1	UTSW	2	127061926	missense	probably benign	0.01
R4454:Ap4e1	UTSW	2	127047141	missense	probably damaging	1.00
R4691:Ap4e1	UTSW	2	127061871	missense	probably benign	0.08
R4767:Ap4e1	UTSW	2	127060438	missense	probably benign
R4803:Ap4e1	UTSW	2	127049559	missense	probably benign	0.20
R4804:Ap4e1	UTSW	2	127043758	critical splice donor site	probably null
R5155:Ap4e1	UTSW	2	127063369	missense	probably benign	0.02
R5157:Ap4e1	UTSW	2	127061695	missense	probably benign	0.00
R5248:Ap4e1	UTSW	2	127064922	missense	possibly damaging	0.95
R5507:Ap4e1	UTSW	2	127008898	missense	probably damaging	0.98
R5642:Ap4e1	UTSW	2	127064979	missense	possibly damaging	0.67
R6122:Ap4e1	UTSW	2	127028160	splice site	probably null
R6180:Ap4e1	UTSW	2	127066588	nonsense	probably null
R6298:Ap4e1	UTSW	2	127047115	missense	probably benign	0.00
R6329:Ap4e1	UTSW	2	127061716	missense	probably benign	0.10
R6543:Ap4e1	UTSW	2	127066605	missense	probably benign	0.03
R6954:Ap4e1	UTSW	2	127064951	missense	probably benign	0.01
R7144:Ap4e1	UTSW	2	127011807	missense	probably damaging	0.99
R7165:Ap4e1	UTSW	2	127063318	missense	possibly damaging	0.48
R7348:Ap4e1	UTSW	2	127061976	missense	probably damaging	0.96
R7348:Ap4e1	UTSW	2	127061977	missense	possibly damaging	0.76
R7382:Ap4e1	UTSW	2	127008902	critical splice donor site	probably null
R7571:Ap4e1	UTSW	2	127019336	missense	probably damaging	1.00
R7768:Ap4e1	UTSW	2	127046934	missense	probably damaging	1.00
R8875:Ap4e1	UTSW	2	127035180	missense	probably damaging	1.00
R9135:Ap4e1	UTSW	2	127019322	missense	probably damaging	1.00
X0060:Ap4e1	UTSW	2	127063410	missense	probably benign	0.01
X0065:Ap4e1	UTSW	2	127061650	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTGGCTGAGTAGTCCCTTTG -3'
(R):5'- GACTTGCATATCTATACTCATGCACAC -3'

Sequencing Primer
(F):5'- TAGTCCCTTTGGTAAAGTAGGAAG -3'
(R):5'- ATATCTATACTCATGCACACAAAGTC -3'

Posted On

2016-08-04