Mutagenetix > Incidental Mutations

Incidental Mutation 'R5363:Cdh4'

422914

Institutional Source

Beutler Lab

Gene Symbol

Cdh4

Ensembl Gene

ENSMUSG00000000305

Gene Name

cadherin 4

Synonyms

R-Cadh, Rcad, R-cadherin

MMRRC Submission

042941-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5363 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

179442431-179899373 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 179886763 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 555 (T555A)

Ref Sequence

ENSEMBL: ENSMUSP00000000314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000314]

AlphaFold

P39038

Predicted Effect

probably benign
Transcript: ENSMUST00000000314
AA Change: T555A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000000314
Gene: ENSMUSG00000000305
AA Change: T555A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Cadherin_pro	30	121	1.18e-30	SMART
CA	187	272	2.31e-15	SMART
CA	296	387	4.33e-29	SMART
CA	410	503	2.21e-12	SMART
CA	526	610	7.16e-21	SMART
CA	630	715	3.78e-2	SMART
transmembrane domain	730	752	N/A	INTRINSIC
Pfam:Cadherin_C	760	909	2.5e-52	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. The encoded protein is involved in retinal angiogenesis during development where it plays a crucial role in the endothelial-astrocyte interactions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in dilation of the proximal renal tubules and extensive vacuolization of tubule epithelium. Uretic bud epithelium appear disorganized and exhibit increased apoptosis at E15.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Abca1	A	G	4: 53,132,963	I40T	probably benign	Het
Abca13	T	C	11: 9,277,035	V597A	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc1	A	G	2: 128,650,194		probably null	Het
Ap4e1	G	A	2: 127,037,864		probably null	Het
Apod	T	C	16: 31,311,091	T16A	probably benign	Het
Arrdc5	C	T	17: 56,300,138	V36M	probably damaging	Het
Bcan	A	G	3: 87,995,487	V328A	probably damaging	Het
Bche	A	G	3: 73,700,639	Y485H	probably damaging	Het
Btbd6	A	G	12: 112,978,136	Y356C	probably damaging	Het
Ciita	C	T	16: 10,512,167	H769Y	probably damaging	Het
Clspn	A	G	4: 126,561,786	D35G	possibly damaging	Het
Cpsf3	T	A	12: 21,308,985	M562K	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cyp2a22	T	A	7: 26,936,433	Q235L	probably damaging	Het
Dicer1	A	G	12: 104,703,151	S1091P	probably damaging	Het
Dync1li1	T	A	9: 114,715,229	I323N	probably damaging	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat4	A	G	3: 38,888,005	N349S	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Hectd4	T	C	5: 121,310,603	M338T	probably benign	Het
Lactb2	A	T	1: 13,630,132	I225N	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mrps30	A	G	13: 118,387,162	S25P	probably benign	Het
Myg1	T	C	15: 102,337,824	V378A	probably benign	Het
Notch4	C	T	17: 34,587,123	T1731I	probably damaging	Het
Ntmt1	A	G	2: 30,820,648	D121G	probably damaging	Het
Olfr1167	A	T	2: 88,149,802	D72E	probably damaging	Het
Olfr763	C	A	10: 129,011,914	P210T	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pclo	A	G	5: 14,669,410	D1187G	unknown	Het
Pkd1	T	A	17: 24,565,073	Y198N	probably benign	Het
Plk4	T	A	3: 40,801,984	N83K	possibly damaging	Het
Prune2	A	T	19: 17,118,266	Q378L	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rasa1	G	T	13: 85,288,555	T118K	possibly damaging	Het
Rin3	G	A	12: 102,325,834	V97M	probably damaging	Het
Rock2	T	C	12: 16,965,654		probably null	Het
Slc34a1	A	G	13: 55,403,268	I289V	probably benign	Het
Slc34a1	T	C	13: 55,412,290	L443P	probably damaging	Het
Slco2a1	A	T	9: 103,070,263	I254F	probably damaging	Het
Spink11	T	C	18: 44,195,686	I32V	probably benign	Het
Spire1	T	C	18: 67,506,555	E296G	probably damaging	Het
Sun1	A	G	5: 139,234,743	N410D	probably damaging	Het
Syt14	T	A	1: 192,930,663	T610S	possibly damaging	Het
Tenm3	T	C	8: 48,287,831	I1206V	possibly damaging	Het
Tet3	A	T	6: 83,376,764		probably null	Het
Thbs1	A	T	2: 118,122,666	Q919L	probably damaging	Het
Trappc10	A	G	10: 78,188,840	F1152L	possibly damaging	Het
Trp63	C	A	16: 25,863,718	N176K	probably damaging	Het
Zbtb17	A	G	4: 141,466,761	E700G	probably benign	Het
Zfp446	G	A	7: 12,978,057	R69H	probably benign	Het
Zfy2	C	T	Y: 2,106,555	C693Y	possibly damaging	Het
Zxdc	A	G	6: 90,382,146	T587A	probably damaging	Het
Zyg11a	A	G	4: 108,189,622	C552R	probably damaging	Het

Other mutations in Cdh4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Cdh4	APN	2	179874144	missense	probably damaging	1.00
IGL01411:Cdh4	APN	2	179780403	missense	probably damaging	0.96
IGL01752:Cdh4	APN	2	179890884	missense	probably damaging	1.00
IGL02814:Cdh4	APN	2	179780474	missense	probably benign	0.01
R0082:Cdh4	UTSW	2	179894188	missense	possibly damaging	0.75
R0357:Cdh4	UTSW	2	179847340	missense	probably damaging	1.00
R1521:Cdh4	UTSW	2	179797558	missense	probably damaging	1.00
R1591:Cdh4	UTSW	2	179886864	critical splice donor site	probably null
R1622:Cdh4	UTSW	2	179889092	missense	possibly damaging	0.56
R1762:Cdh4	UTSW	2	179797480	missense	probably benign	0.01
R1794:Cdh4	UTSW	2	179886842	missense	probably damaging	1.00
R2275:Cdh4	UTSW	2	179890847	missense	probably damaging	1.00
R2277:Cdh4	UTSW	2	179797524	missense	possibly damaging	0.88
R3686:Cdh4	UTSW	2	179780367	missense	probably benign	0.09
R3861:Cdh4	UTSW	2	179874097	missense	probably damaging	1.00
R4078:Cdh4	UTSW	2	179889173	missense	possibly damaging	0.93
R4495:Cdh4	UTSW	2	179780389	missense	probably damaging	0.98
R4715:Cdh4	UTSW	2	179780467	missense	probably benign	0.03
R4893:Cdh4	UTSW	2	179847419	intron	probably benign
R5029:Cdh4	UTSW	2	179881949	missense	possibly damaging	0.93
R5542:Cdh4	UTSW	2	179860226	missense	probably damaging	0.98
R5773:Cdh4	UTSW	2	179885996	missense	probably damaging	1.00
R5791:Cdh4	UTSW	2	179895767	missense	probably damaging	1.00
R6262:Cdh4	UTSW	2	179797626	missense	probably damaging	1.00
R6338:Cdh4	UTSW	2	179890812	missense	probably damaging	1.00
R6589:Cdh4	UTSW	2	179881996	critical splice donor site	probably null
R6607:Cdh4	UTSW	2	179874096	missense	probably benign	0.00
R6653:Cdh4	UTSW	2	179780428	missense	probably benign	0.34
R6711:Cdh4	UTSW	2	179890931	missense	probably damaging	1.00
R6744:Cdh4	UTSW	2	179847387	missense	possibly damaging	0.68
R6824:Cdh4	UTSW	2	179797558	missense	probably damaging	1.00
R6901:Cdh4	UTSW	2	179860194	missense	probably benign	0.19
R6981:Cdh4	UTSW	2	179797504	missense	probably benign	0.28
R7285:Cdh4	UTSW	2	179797465	missense	probably benign	0.00
R7514:Cdh4	UTSW	2	179890843	missense	possibly damaging	0.91
R7541:Cdh4	UTSW	2	179444810	splice site	probably null
R7560:Cdh4	UTSW	2	179890902	missense	probably benign	0.25
R8146:Cdh4	UTSW	2	179874078	missense	possibly damaging	0.91
R8833:Cdh4	UTSW	2	179894035	missense	possibly damaging	0.61
R9075:Cdh4	UTSW	2	179860147	missense	probably damaging	0.97
R9203:Cdh4	UTSW	2	179780403	missense	probably damaging	0.96
Z1177:Cdh4	UTSW	2	179780326	missense	probably benign	0.45

Predicted Primers

PCR Primer
(F):5'- GGTCCTCCAGTATCTAAGACCAC -3'
(R):5'- TGGCTGCCTGTACAGACTTC -3'

Sequencing Primer
(F):5'- TTATGTAGGAGGCGCACCG -3'
(R):5'- GTACAGACTTCTTCCCACCCAG -3'

Posted On

2016-08-04