Incidental Mutation 'R5363:Plk4'
ID 422917
Institutional Source Beutler Lab
Gene Symbol Plk4
Ensembl Gene ENSMUSG00000025758
Gene Name polo like kinase 4
Synonyms Stk18, Sak
MMRRC Submission 042941-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5363 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 40754463-40771318 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 40756419 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 83 (N83K)
Ref Sequence ENSEMBL: ENSMUSP00000145455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026858] [ENSMUST00000167556] [ENSMUST00000203295] [ENSMUST00000203895] [ENSMUST00000204473]
AlphaFold Q64702
Predicted Effect possibly damaging
Transcript: ENSMUST00000026858
AA Change: N83K

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026858
Gene: ENSMUSG00000025758
AA Change: N83K

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 554 774 6e-41 PDB
low complexity region 820 831 N/A INTRINSIC
Pfam:POLO_box 849 910 7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166936
AA Change: L149I
Predicted Effect possibly damaging
Transcript: ENSMUST00000167556
AA Change: N83K

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126945
Gene: ENSMUSG00000025758
AA Change: N83K

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 551 771 6e-41 PDB
low complexity region 817 828 N/A INTRINSIC
Pfam:POLO_box 844 908 1.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168363
AA Change: L159I
Predicted Effect possibly damaging
Transcript: ENSMUST00000203295
AA Change: N83K

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145277
Gene: ENSMUSG00000025758
AA Change: N83K

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 554 747 3e-32 PDB
low complexity region 793 804 N/A INTRINSIC
Pfam:POLO_box 822 883 6.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203320
Predicted Effect possibly damaging
Transcript: ENSMUST00000203895
AA Change: N83K

PolyPhen 2 Score 0.709 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145455
Gene: ENSMUSG00000025758
AA Change: N83K

DomainStartEndE-ValueType
STYKc 12 143 3.5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204289
Predicted Effect possibly damaging
Transcript: ENSMUST00000204473
AA Change: N84K

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144693
Gene: ENSMUSG00000025758
AA Change: N84K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 13 114 4.9e-17 PFAM
Pfam:Pkinase 13 115 2.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205046
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the polo family of serine/threonine protein kinases. The protein localizes to the nucleolus during G2, to centrosomes during G2/M, and to the cleavage furrow during cytokinesis. It is required for progression through mitosis, cell survival, and embryonic development. The mouse genome contains a pseudogene similar to this gene. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for disruptions of this gene die before birth. Development is arrested around E7.5. Mice heterozygous for an ENU-induced allele or gene trap alele exhibit male hypogonadism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,132,963 (GRCm39) I40T probably benign Het
Abca13 T C 11: 9,227,035 (GRCm39) V597A possibly damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Anapc1 A G 2: 128,492,114 (GRCm39) probably null Het
Ap4e1 G A 2: 126,879,784 (GRCm39) probably null Het
Apod T C 16: 31,129,909 (GRCm39) T16A probably benign Het
Arrdc5 C T 17: 56,607,138 (GRCm39) V36M probably damaging Het
Bcan A G 3: 87,902,794 (GRCm39) V328A probably damaging Het
Bche A G 3: 73,607,972 (GRCm39) Y485H probably damaging Het
Btbd6 A G 12: 112,941,756 (GRCm39) Y356C probably damaging Het
Cdh4 A G 2: 179,528,556 (GRCm39) T555A probably benign Het
Ciita C T 16: 10,330,031 (GRCm39) H769Y probably damaging Het
Clspn A G 4: 126,455,579 (GRCm39) D35G possibly damaging Het
Cpsf3 T A 12: 21,358,986 (GRCm39) M562K probably benign Het
Cstdc1 G T 2: 148,625,298 (GRCm39) L77F probably damaging Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,759,803 (GRCm39) probably null Het
Cyp2a22 T A 7: 26,635,858 (GRCm39) Q235L probably damaging Het
Dicer1 A G 12: 104,669,410 (GRCm39) S1091P probably damaging Het
Dync1li1 T A 9: 114,544,297 (GRCm39) I323N probably damaging Het
Fat4 A G 3: 38,942,154 (GRCm39) N349S probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Hectd4 T C 5: 121,448,666 (GRCm39) M338T probably benign Het
Insyn2b G A 11: 34,352,788 (GRCm39) E277K probably damaging Het
Lactb2 A T 1: 13,700,356 (GRCm39) I225N probably benign Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Mrps30 A G 13: 118,523,698 (GRCm39) S25P probably benign Het
Myg1 T C 15: 102,246,259 (GRCm39) V378A probably benign Het
Notch4 C T 17: 34,806,097 (GRCm39) T1731I probably damaging Het
Ntmt1 A G 2: 30,710,660 (GRCm39) D121G probably damaging Het
Or10p21 C A 10: 128,847,783 (GRCm39) P210T probably damaging Het
Or5d39 A T 2: 87,980,146 (GRCm39) D72E probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pclo A G 5: 14,719,424 (GRCm39) D1187G unknown Het
Pkd1 T A 17: 24,784,047 (GRCm39) Y198N probably benign Het
Prune2 A T 19: 17,095,630 (GRCm39) Q378L probably damaging Het
R3hdm4 C T 10: 79,748,292 (GRCm39) E162K possibly damaging Het
Rasa1 G T 13: 85,436,674 (GRCm39) T118K possibly damaging Het
Rin3 G A 12: 102,292,093 (GRCm39) V97M probably damaging Het
Rock2 T C 12: 17,015,655 (GRCm39) probably null Het
Slc34a1 A G 13: 55,551,081 (GRCm39) I289V probably benign Het
Slc34a1 T C 13: 55,560,103 (GRCm39) L443P probably damaging Het
Slco2a1 A T 9: 102,947,462 (GRCm39) I254F probably damaging Het
Spink11 T C 18: 44,328,753 (GRCm39) I32V probably benign Het
Spire1 T C 18: 67,639,625 (GRCm39) E296G probably damaging Het
Sun1 A G 5: 139,220,498 (GRCm39) N410D probably damaging Het
Syt14 T A 1: 192,612,971 (GRCm39) T610S possibly damaging Het
Tenm3 T C 8: 48,740,866 (GRCm39) I1206V possibly damaging Het
Tet3 A T 6: 83,353,746 (GRCm39) probably null Het
Thbs1 A T 2: 117,953,147 (GRCm39) Q919L probably damaging Het
Trappc10 A G 10: 78,024,674 (GRCm39) F1152L possibly damaging Het
Trp63 C A 16: 25,682,468 (GRCm39) N176K probably damaging Het
Zbtb17 A G 4: 141,194,072 (GRCm39) E700G probably benign Het
Zfp446 G A 7: 12,711,984 (GRCm39) R69H probably benign Het
Zfy2 C T Y: 2,106,555 (GRCm39) C693Y possibly damaging Het
Zxdc A G 6: 90,359,128 (GRCm39) T587A probably damaging Het
Zyg11a A G 4: 108,046,819 (GRCm39) C552R probably damaging Het
Other mutations in Plk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Plk4 APN 3 40,756,224 (GRCm39) missense probably damaging 1.00
IGL01730:Plk4 APN 3 40,760,285 (GRCm39) missense probably benign 0.00
IGL01906:Plk4 APN 3 40,764,816 (GRCm39) missense probably null 0.01
IGL02021:Plk4 APN 3 40,765,143 (GRCm39) missense probably damaging 0.97
IGL02718:Plk4 APN 3 40,769,456 (GRCm39) missense probably damaging 1.00
IGL03287:Plk4 APN 3 40,759,553 (GRCm39) missense probably benign 0.11
R0058:Plk4 UTSW 3 40,760,307 (GRCm39) missense probably benign
R0058:Plk4 UTSW 3 40,760,307 (GRCm39) missense probably benign
R0312:Plk4 UTSW 3 40,767,982 (GRCm39) missense probably damaging 0.97
R0387:Plk4 UTSW 3 40,767,319 (GRCm39) splice site probably benign
R0411:Plk4 UTSW 3 40,765,654 (GRCm39) unclassified probably benign
R0480:Plk4 UTSW 3 40,760,075 (GRCm39) missense probably benign 0.15
R1170:Plk4 UTSW 3 40,756,282 (GRCm39) missense probably damaging 1.00
R1268:Plk4 UTSW 3 40,765,804 (GRCm39) missense probably damaging 1.00
R1529:Plk4 UTSW 3 40,760,971 (GRCm39) missense probably benign 0.09
R1987:Plk4 UTSW 3 40,760,252 (GRCm39) missense possibly damaging 0.60
R1988:Plk4 UTSW 3 40,760,252 (GRCm39) missense possibly damaging 0.60
R2050:Plk4 UTSW 3 40,764,815 (GRCm39) missense probably benign
R4409:Plk4 UTSW 3 40,760,984 (GRCm39) missense probably damaging 0.98
R4727:Plk4 UTSW 3 40,759,589 (GRCm39) missense probably benign 0.00
R4765:Plk4 UTSW 3 40,756,457 (GRCm39) missense probably damaging 1.00
R4772:Plk4 UTSW 3 40,759,625 (GRCm39) missense probably damaging 1.00
R5022:Plk4 UTSW 3 40,756,512 (GRCm39) splice site probably null
R5651:Plk4 UTSW 3 40,767,940 (GRCm39) missense probably benign 0.00
R5665:Plk4 UTSW 3 40,768,021 (GRCm39) missense possibly damaging 0.79
R5724:Plk4 UTSW 3 40,755,481 (GRCm39) missense probably damaging 1.00
R6391:Plk4 UTSW 3 40,763,408 (GRCm39) missense probably benign 0.05
R6694:Plk4 UTSW 3 40,756,263 (GRCm39) missense probably damaging 1.00
R7412:Plk4 UTSW 3 40,766,613 (GRCm39) missense probably benign
R8047:Plk4 UTSW 3 40,760,187 (GRCm39) missense probably benign
R8165:Plk4 UTSW 3 40,768,009 (GRCm39) missense probably damaging 0.99
R8399:Plk4 UTSW 3 40,763,265 (GRCm39) nonsense probably null
R8411:Plk4 UTSW 3 40,767,901 (GRCm39) missense probably benign
R8724:Plk4 UTSW 3 40,768,022 (GRCm39) missense probably damaging 0.97
R9222:Plk4 UTSW 3 40,760,990 (GRCm39) missense possibly damaging 0.94
R9294:Plk4 UTSW 3 40,766,326 (GRCm39) missense probably damaging 1.00
R9573:Plk4 UTSW 3 40,763,257 (GRCm39) missense probably benign 0.00
R9794:Plk4 UTSW 3 40,759,535 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCATGTACAAAGCTGGAATGG -3'
(R):5'- GAGGCACACTTATACACATGC -3'

Sequencing Primer
(F):5'- TGGTACAGAGAGTCCAAAATGAGGTG -3'
(R):5'- TCACAATCAGGTTCCAGGGGATC -3'
Posted On 2016-08-04