Mutagenetix > Incidental Mutation

Incidental Mutation 'R5363:Plk4'

422917

Institutional Source

Beutler Lab

Gene Symbol

Plk4

Ensembl Gene

ENSMUSG00000025758

Gene Name

polo like kinase 4

Synonyms

Stk18, Sak

MMRRC Submission

042941-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5363 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40800019-40816883 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 40801984 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 83 (N83K)

Ref Sequence

ENSEMBL: ENSMUSP00000145455 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026858] [ENSMUST00000167556] [ENSMUST00000203295] [ENSMUST00000203895] [ENSMUST00000204473]

AlphaFold

Q64702

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026858
AA Change: N83K

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000026858
Gene: ENSMUSG00000025758
AA Change: N83K

Domain	Start	End	E-Value	Type
S_TKc	12	265	3.46e-100	SMART
low complexity region	288	312	N/A	INTRINSIC
low complexity region	329	341	N/A	INTRINSIC
PDB:4G7N\|B	554	774	6e-41	PDB
low complexity region	820	831	N/A	INTRINSIC
Pfam:POLO_box	849	910	7e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166936
AA Change: L149I

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167556
AA Change: N83K

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000126945
Gene: ENSMUSG00000025758
AA Change: N83K

Domain	Start	End	E-Value	Type
S_TKc	12	265	3.46e-100	SMART
low complexity region	288	312	N/A	INTRINSIC
low complexity region	329	341	N/A	INTRINSIC
PDB:4G7N\|B	551	771	6e-41	PDB
low complexity region	817	828	N/A	INTRINSIC
Pfam:POLO_box	844	908	1.6e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168363
AA Change: L159I

Predicted Effect

possibly damaging
Transcript: ENSMUST00000203295
AA Change: N83K

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000145277
Gene: ENSMUSG00000025758
AA Change: N83K

Domain	Start	End	E-Value	Type
S_TKc	12	265	3.46e-100	SMART
low complexity region	288	312	N/A	INTRINSIC
low complexity region	329	341	N/A	INTRINSIC
PDB:4G7N\|B	554	747	3e-32	PDB
low complexity region	793	804	N/A	INTRINSIC
Pfam:POLO_box	822	883	6.7e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203320

Predicted Effect

possibly damaging
Transcript: ENSMUST00000203895
AA Change: N83K

PolyPhen 2 Score 0.709 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000145455
Gene: ENSMUSG00000025758
AA Change: N83K

Domain	Start	End	E-Value	Type
STYKc	12	143	3.5e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204289

Predicted Effect

possibly damaging
Transcript: ENSMUST00000204473
AA Change: N84K

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000144693
Gene: ENSMUSG00000025758
AA Change: N84K

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	13	114	4.9e-17	PFAM
Pfam:Pkinase	13	115	2.4e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204594

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205046

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the polo family of serine/threonine protein kinases. The protein localizes to the nucleolus during G2, to centrosomes during G2/M, and to the cleavage furrow during cytokinesis. It is required for progression through mitosis, cell survival, and embryonic development. The mouse genome contains a pseudogene similar to this gene. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for disruptions of this gene die before birth. Development is arrested around E7.5. Mice heterozygous for an ENU-induced allele or gene trap alele exhibit male hypogonadism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Abca1	A	G	4: 53,132,963	I40T	probably benign	Het
Abca13	T	C	11: 9,277,035	V597A	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc1	A	G	2: 128,650,194		probably null	Het
Ap4e1	G	A	2: 127,037,864		probably null	Het
Apod	T	C	16: 31,311,091	T16A	probably benign	Het
Arrdc5	C	T	17: 56,300,138	V36M	probably damaging	Het
Bcan	A	G	3: 87,995,487	V328A	probably damaging	Het
Bche	A	G	3: 73,700,639	Y485H	probably damaging	Het
Btbd6	A	G	12: 112,978,136	Y356C	probably damaging	Het
Cdh4	A	G	2: 179,886,763	T555A	probably benign	Het
Ciita	C	T	16: 10,512,167	H769Y	probably damaging	Het
Clspn	A	G	4: 126,561,786	D35G	possibly damaging	Het
Cpsf3	T	A	12: 21,308,985	M562K	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cyp2a22	T	A	7: 26,936,433	Q235L	probably damaging	Het
Dicer1	A	G	12: 104,703,151	S1091P	probably damaging	Het
Dync1li1	T	A	9: 114,715,229	I323N	probably damaging	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat4	A	G	3: 38,888,005	N349S	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Hectd4	T	C	5: 121,310,603	M338T	probably benign	Het
Lactb2	A	T	1: 13,630,132	I225N	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mrps30	A	G	13: 118,387,162	S25P	probably benign	Het
Myg1	T	C	15: 102,337,824	V378A	probably benign	Het
Notch4	C	T	17: 34,587,123	T1731I	probably damaging	Het
Ntmt1	A	G	2: 30,820,648	D121G	probably damaging	Het
Olfr1167	A	T	2: 88,149,802	D72E	probably damaging	Het
Olfr763	C	A	10: 129,011,914	P210T	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pclo	A	G	5: 14,669,410	D1187G	unknown	Het
Pkd1	T	A	17: 24,565,073	Y198N	probably benign	Het
Prune2	A	T	19: 17,118,266	Q378L	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rasa1	G	T	13: 85,288,555	T118K	possibly damaging	Het
Rin3	G	A	12: 102,325,834	V97M	probably damaging	Het
Rock2	T	C	12: 16,965,654		probably null	Het
Slc34a1	A	G	13: 55,403,268	I289V	probably benign	Het
Slc34a1	T	C	13: 55,412,290	L443P	probably damaging	Het
Slco2a1	A	T	9: 103,070,263	I254F	probably damaging	Het
Spink11	T	C	18: 44,195,686	I32V	probably benign	Het
Spire1	T	C	18: 67,506,555	E296G	probably damaging	Het
Sun1	A	G	5: 139,234,743	N410D	probably damaging	Het
Syt14	T	A	1: 192,930,663	T610S	possibly damaging	Het
Tenm3	T	C	8: 48,287,831	I1206V	possibly damaging	Het
Tet3	A	T	6: 83,376,764		probably null	Het
Thbs1	A	T	2: 118,122,666	Q919L	probably damaging	Het
Trappc10	A	G	10: 78,188,840	F1152L	possibly damaging	Het
Trp63	C	A	16: 25,863,718	N176K	probably damaging	Het
Zbtb17	A	G	4: 141,466,761	E700G	probably benign	Het
Zfp446	G	A	7: 12,978,057	R69H	probably benign	Het
Zfy2	C	T	Y: 2,106,555	C693Y	possibly damaging	Het
Zxdc	A	G	6: 90,382,146	T587A	probably damaging	Het
Zyg11a	A	G	4: 108,189,622	C552R	probably damaging	Het

Other mutations in Plk4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00719:Plk4	APN	3	40801789	missense	probably damaging	1.00
IGL01730:Plk4	APN	3	40805850	missense	probably benign	0.00
IGL01906:Plk4	APN	3	40810381	missense	probably null	0.01
IGL02021:Plk4	APN	3	40810708	missense	probably damaging	0.97
IGL02718:Plk4	APN	3	40815021	missense	probably damaging	1.00
IGL03287:Plk4	APN	3	40805118	missense	probably benign	0.11
R0058:Plk4	UTSW	3	40805872	missense	probably benign
R0058:Plk4	UTSW	3	40805872	missense	probably benign
R0312:Plk4	UTSW	3	40813547	missense	probably damaging	0.97
R0387:Plk4	UTSW	3	40812884	splice site	probably benign
R0411:Plk4	UTSW	3	40811219	unclassified	probably benign
R0480:Plk4	UTSW	3	40805640	missense	probably benign	0.15
R1170:Plk4	UTSW	3	40801847	missense	probably damaging	1.00
R1268:Plk4	UTSW	3	40811369	missense	probably damaging	1.00
R1529:Plk4	UTSW	3	40806536	missense	probably benign	0.09
R1987:Plk4	UTSW	3	40805817	missense	possibly damaging	0.60
R1988:Plk4	UTSW	3	40805817	missense	possibly damaging	0.60
R2050:Plk4	UTSW	3	40810380	missense	probably benign
R4409:Plk4	UTSW	3	40806549	missense	probably damaging	0.98
R4727:Plk4	UTSW	3	40805154	missense	probably benign	0.00
R4765:Plk4	UTSW	3	40802022	missense	probably damaging	1.00
R4772:Plk4	UTSW	3	40805190	missense	probably damaging	1.00
R5022:Plk4	UTSW	3	40802077	splice site	probably null
R5651:Plk4	UTSW	3	40813505	missense	probably benign	0.00
R5665:Plk4	UTSW	3	40813586	missense	possibly damaging	0.79
R5724:Plk4	UTSW	3	40801046	missense	probably damaging	1.00
R6391:Plk4	UTSW	3	40808973	missense	probably benign	0.05
R6694:Plk4	UTSW	3	40801828	missense	probably damaging	1.00
R7412:Plk4	UTSW	3	40812178	missense	probably benign
R8047:Plk4	UTSW	3	40805752	missense	probably benign
R8165:Plk4	UTSW	3	40813574	missense	probably damaging	0.99
R8399:Plk4	UTSW	3	40808830	nonsense	probably null
R8411:Plk4	UTSW	3	40813466	missense	probably benign
R8724:Plk4	UTSW	3	40813587	missense	probably damaging	0.97
R9222:Plk4	UTSW	3	40806555	missense	possibly damaging	0.94
R9294:Plk4	UTSW	3	40811891	missense	probably damaging	1.00
R9573:Plk4	UTSW	3	40808822	missense	probably benign	0.00
R9794:Plk4	UTSW	3	40805100	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCCATGTACAAAGCTGGAATGG -3'
(R):5'- GAGGCACACTTATACACATGC -3'

Sequencing Primer
(F):5'- TGGTACAGAGAGTCCAAAATGAGGTG -3'
(R):5'- TCACAATCAGGTTCCAGGGGATC -3'

Posted On

2016-08-04