Incidental Mutation 'R5363:Bche'
ID422918
Institutional Source Beutler Lab
Gene Symbol Bche
Ensembl Gene ENSMUSG00000027792
Gene Namebutyrylcholinesterase
SynonymsC730038G20Rik
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5363 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location73635808-73708415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73700639 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 485 (Y485H)
Ref Sequence ENSEMBL: ENSMUSP00000029367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029367] [ENSMUST00000138216]
AlphaFold Q03311
Predicted Effect probably damaging
Transcript: ENSMUST00000029367
AA Change: Y485H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029367
Gene: ENSMUSG00000027792
AA Change: Y485H

DomainStartEndE-ValueType
Pfam:COesterase 10 551 5.2e-183 PFAM
Pfam:Abhydrolase_3 139 242 1.9e-7 PFAM
Pfam:AChE_tetra 566 602 8.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133690
Predicted Effect probably benign
Transcript: ENSMUST00000138216
SMART Domains Protein: ENSMUSP00000141329
Gene: ENSMUSG00000027792

DomainStartEndE-ValueType
Pfam:COesterase 10 174 6.9e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153917
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cholinesterase enzyme and member of the type-B carboxylesterase/lipase family of proteins. The encoded enzyme exhibits broad substrate specificity and is involved in the detoxification of poisons including organophosphate nerve agents and pesticides, and the metabolism of drugs including cocaine, heroin and aspirin. Humans homozygous for certain mutations in this gene exhibit prolonged apnea after administration of the muscle relaxant succinylcholine. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any overt abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Bche
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Bche APN 3 73701307 missense probably benign 0.00
IGL01420:Bche APN 3 73702009 missense probably benign 0.03
IGL02433:Bche APN 3 73701929 missense probably benign 0.02
IGL02734:Bche APN 3 73702076 missense probably benign 0.09
IGL03095:Bche APN 3 73701883 missense probably damaging 1.00
IGL03227:Bche APN 3 73701612 missense probably damaging 1.00
R0056:Bche UTSW 3 73701321 missense possibly damaging 0.79
R1780:Bche UTSW 3 73700620 missense probably benign 0.00
R1984:Bche UTSW 3 73701826 missense probably benign 0.03
R1984:Bche UTSW 3 73701827 missense probably benign
R2403:Bche UTSW 3 73701472 missense probably damaging 0.96
R4989:Bche UTSW 3 73701844 missense probably benign 0.02
R5231:Bche UTSW 3 73700861 missense probably benign 0.07
R5987:Bche UTSW 3 73648678 missense possibly damaging 0.59
R6164:Bche UTSW 3 73701056 missense possibly damaging 0.63
R6381:Bche UTSW 3 73701799 missense probably benign 0.00
R6571:Bche UTSW 3 73701491 missense probably benign 0.08
R6801:Bche UTSW 3 73701800 missense probably benign
R6935:Bche UTSW 3 73701800 missense probably benign
R7275:Bche UTSW 3 73700636 missense probably benign 0.19
R7499:Bche UTSW 3 73701898 missense probably damaging 1.00
R7543:Bche UTSW 3 73701733 missense probably damaging 1.00
R7757:Bche UTSW 3 73701121 missense probably damaging 1.00
R7965:Bche UTSW 3 73701816 missense probably damaging 0.98
R8878:Bche UTSW 3 73701173 missense probably benign
R8944:Bche UTSW 3 73700675 missense probably damaging 1.00
R8947:Bche UTSW 3 73701428 missense probably damaging 0.97
R8964:Bche UTSW 3 73701073 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGCTAAAATTCACCACATTGTGAG -3'
(R):5'- ACATCATCTGCCCTGCACTG -3'

Sequencing Primer
(F):5'- TTCACCACATTGTGAGACAAAAAGG -3'
(R):5'- CCTGCACTGGAGTTTACCAAG -3'
Posted On2016-08-04