Mutagenetix > Incidental Mutations

Incidental Mutation 'R5363:Clspn'

422922

Institutional Source

Beutler Lab

Gene Symbol

Clspn

Ensembl Gene

ENSMUSG00000042489

Gene Name

claspin

Synonyms

C85083, E130314M08Rik

MMRRC Submission

042941-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5363 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

126556935-126593903 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 126561786 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 35 (D35G)

Ref Sequence

ENSEMBL: ENSMUSP00000120683 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048391] [ENSMUST00000129795] [ENSMUST00000147675]

AlphaFold

Q80YR7

Predicted Effect

probably benign
Transcript: ENSMUST00000048391
AA Change: D199G

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: D199G

Domain	Start	End	E-Value	Type
low complexity region	64	75	N/A	INTRINSIC
coiled coil region	159	187	N/A	INTRINSIC
low complexity region	214	230	N/A	INTRINSIC
low complexity region	232	245	N/A	INTRINSIC
low complexity region	477	490	N/A	INTRINSIC
coiled coil region	599	626	N/A	INTRINSIC
low complexity region	632	658	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	732	753	N/A	INTRINSIC
low complexity region	793	812	N/A	INTRINSIC
low complexity region	968	975	N/A	INTRINSIC
coiled coil region	1001	1036	N/A	INTRINSIC
low complexity region	1045	1064	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123695

Predicted Effect

probably benign
Transcript: ENSMUST00000126512

SMART Domains

Protein: ENSMUSP00000119437
Gene: ENSMUSG00000042489

Domain	Start	End	E-Value	Type
coiled coil region	74	101	N/A	INTRINSIC
low complexity region	108	147	N/A	INTRINSIC
low complexity region	153	170	N/A	INTRINSIC
low complexity region	221	242	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000129795
AA Change: D35G

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000120683
Gene: ENSMUSG00000042489
AA Change: D35G

Domain	Start	End	E-Value	Type
low complexity region	50	66	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147675

SMART Domains

Protein: ENSMUSP00000116699
Gene: ENSMUSG00000042489

Domain	Start	End	E-Value	Type
low complexity region	60	71	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185054

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Abca1	A	G	4: 53,132,963	I40T	probably benign	Het
Abca13	T	C	11: 9,277,035	V597A	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc1	A	G	2: 128,650,194		probably null	Het
Ap4e1	G	A	2: 127,037,864		probably null	Het
Apod	T	C	16: 31,311,091	T16A	probably benign	Het
Arrdc5	C	T	17: 56,300,138	V36M	probably damaging	Het
Bcan	A	G	3: 87,995,487	V328A	probably damaging	Het
Bche	A	G	3: 73,700,639	Y485H	probably damaging	Het
Btbd6	A	G	12: 112,978,136	Y356C	probably damaging	Het
Cdh4	A	G	2: 179,886,763	T555A	probably benign	Het
Ciita	C	T	16: 10,512,167	H769Y	probably damaging	Het
Cpsf3	T	A	12: 21,308,985	M562K	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cyp2a22	T	A	7: 26,936,433	Q235L	probably damaging	Het
Dicer1	A	G	12: 104,703,151	S1091P	probably damaging	Het
Dync1li1	T	A	9: 114,715,229	I323N	probably damaging	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat4	A	G	3: 38,888,005	N349S	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Hectd4	T	C	5: 121,310,603	M338T	probably benign	Het
Lactb2	A	T	1: 13,630,132	I225N	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mrps30	A	G	13: 118,387,162	S25P	probably benign	Het
Myg1	T	C	15: 102,337,824	V378A	probably benign	Het
Notch4	C	T	17: 34,587,123	T1731I	probably damaging	Het
Ntmt1	A	G	2: 30,820,648	D121G	probably damaging	Het
Olfr1167	A	T	2: 88,149,802	D72E	probably damaging	Het
Olfr763	C	A	10: 129,011,914	P210T	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pclo	A	G	5: 14,669,410	D1187G	unknown	Het
Pkd1	T	A	17: 24,565,073	Y198N	probably benign	Het
Plk4	T	A	3: 40,801,984	N83K	possibly damaging	Het
Prune2	A	T	19: 17,118,266	Q378L	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rasa1	G	T	13: 85,288,555	T118K	possibly damaging	Het
Rin3	G	A	12: 102,325,834	V97M	probably damaging	Het
Rock2	T	C	12: 16,965,654		probably null	Het
Slc34a1	A	G	13: 55,403,268	I289V	probably benign	Het
Slc34a1	T	C	13: 55,412,290	L443P	probably damaging	Het
Slco2a1	A	T	9: 103,070,263	I254F	probably damaging	Het
Spink11	T	C	18: 44,195,686	I32V	probably benign	Het
Spire1	T	C	18: 67,506,555	E296G	probably damaging	Het
Sun1	A	G	5: 139,234,743	N410D	probably damaging	Het
Syt14	T	A	1: 192,930,663	T610S	possibly damaging	Het
Tenm3	T	C	8: 48,287,831	I1206V	possibly damaging	Het
Tet3	A	T	6: 83,376,764		probably null	Het
Thbs1	A	T	2: 118,122,666	Q919L	probably damaging	Het
Trappc10	A	G	10: 78,188,840	F1152L	possibly damaging	Het
Trp63	C	A	16: 25,863,718	N176K	probably damaging	Het
Zbtb17	A	G	4: 141,466,761	E700G	probably benign	Het
Zfp446	G	A	7: 12,978,057	R69H	probably benign	Het
Zfy2	C	T	Y: 2,106,555	C693Y	possibly damaging	Het
Zxdc	A	G	6: 90,382,146	T587A	probably damaging	Het
Zyg11a	A	G	4: 108,189,622	C552R	probably damaging	Het

Other mutations in Clspn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Clspn	APN	4	126573178	missense	probably damaging	1.00
IGL02160:Clspn	APN	4	126581510	missense	probably benign	0.21
IGL02231:Clspn	APN	4	126559228	missense	probably damaging	0.98
IGL02281:Clspn	APN	4	126565770	missense	possibly damaging	0.90
IGL02368:Clspn	APN	4	126566107	missense	probably benign
IGL03149:Clspn	APN	4	126576502	splice site	probably benign
Durch	UTSW	4	126580962	missense	probably damaging	0.99
R0012:Clspn	UTSW	4	126564929	unclassified	probably benign
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0207:Clspn	UTSW	4	126590598	missense	possibly damaging	0.82
R0270:Clspn	UTSW	4	126573236	missense	probably damaging	1.00
R0825:Clspn	UTSW	4	126573130	splice site	probably benign
R1082:Clspn	UTSW	4	126577779	missense	possibly damaging	0.95
R1349:Clspn	UTSW	4	126563977	missense	probably benign
R1568:Clspn	UTSW	4	126581517	missense	probably benign	0.01
R1649:Clspn	UTSW	4	126566435	unclassified	probably benign
R1663:Clspn	UTSW	4	126565975	missense	probably benign	0.00
R2497:Clspn	UTSW	4	126572347	missense	possibly damaging	0.79
R3107:Clspn	UTSW	4	126591659	missense	probably benign	0.06
R3951:Clspn	UTSW	4	126576379	missense	probably damaging	1.00
R3953:Clspn	UTSW	4	126566437	frame shift	probably null
R3954:Clspn	UTSW	4	126566437	frame shift	probably null
R3956:Clspn	UTSW	4	126566437	frame shift	probably null
R4599:Clspn	UTSW	4	126581460	missense	probably benign	0.14
R4717:Clspn	UTSW	4	126560056	missense	probably damaging	1.00
R4853:Clspn	UTSW	4	126566555	missense	probably damaging	0.99
R4854:Clspn	UTSW	4	126575950	missense	probably benign
R4979:Clspn	UTSW	4	126578386	missense	probably damaging	1.00
R5531:Clspn	UTSW	4	126577773	missense	probably benign
R5614:Clspn	UTSW	4	126580962	missense	probably damaging	0.99
R5706:Clspn	UTSW	4	126578418	missense	probably damaging	1.00
R5806:Clspn	UTSW	4	126586106	missense	probably damaging	1.00
R6106:Clspn	UTSW	4	126590641	missense	probably benign	0.00
R6178:Clspn	UTSW	4	126577736	splice site	probably null
R6223:Clspn	UTSW	4	126586168	missense	probably damaging	0.99
R6326:Clspn	UTSW	4	126565739	missense	probably damaging	1.00
R6398:Clspn	UTSW	4	126563947	missense	probably damaging	1.00
R6714:Clspn	UTSW	4	126565768	missense	probably damaging	1.00
R7003:Clspn	UTSW	4	126592720	missense	possibly damaging	0.63
R7034:Clspn	UTSW	4	126580982	missense	possibly damaging	0.87
R7358:Clspn	UTSW	4	126566200	missense	probably benign	0.02
R7376:Clspn	UTSW	4	126590637	missense	possibly damaging	0.65
R7675:Clspn	UTSW	4	126566320	missense	probably benign	0.00
R8320:Clspn	UTSW	4	126563950	missense	possibly damaging	0.73
R8517:Clspn	UTSW	4	126566219	missense	probably benign	0.00
R8547:Clspn	UTSW	4	126561816	missense	probably damaging	1.00
R9223:Clspn	UTSW	4	126590618	missense	possibly damaging	0.60
R9361:Clspn	UTSW	4	126585861	missense	probably damaging	0.99
T0975:Clspn	UTSW	4	126566437	unclassified	probably benign
X0014:Clspn	UTSW	4	126575943	missense	probably damaging	1.00
Z1177:Clspn	UTSW	4	126566177	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AACCACAGCTTGAGTTTCAAAGG -3'
(R):5'- GTCTCTTCACCAAGTCCCAG -3'

Sequencing Primer
(F):5'- CCACAGCTTGAGTTTCAAAGGGTAAG -3'
(R):5'- TACAAGGGACCAAGGTTCGTTCC -3'

Posted On

2016-08-04