Incidental Mutation 'R5363:Hectd4'
ID422924
Institutional Source Beutler Lab
Gene Symbol Hectd4
Ensembl Gene ENSMUSG00000042744
Gene NameHECT domain E3 ubiquitin protein ligase 4
SynonymsGm15800
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.883) question?
Stock #R5363 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location121220219-121368577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121310603 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 338 (M338T)
Ref Sequence ENSEMBL: ENSMUSP00000098332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042614] [ENSMUST00000100769]
Predicted Effect probably benign
Transcript: ENSMUST00000042614
AA Change: M1675T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: M1675T

DomainStartEndE-ValueType
low complexity region 224 234 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 725 735 N/A INTRINSIC
low complexity region 1252 1265 N/A INTRINSIC
coiled coil region 1372 1398 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1892 1904 N/A INTRINSIC
low complexity region 2656 2666 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
low complexity region 2901 2917 N/A INTRINSIC
low complexity region 2921 2933 N/A INTRINSIC
low complexity region 3232 3246 N/A INTRINSIC
low complexity region 3275 3335 N/A INTRINSIC
low complexity region 3441 3448 N/A INTRINSIC
low complexity region 3473 3506 N/A INTRINSIC
low complexity region 3512 3533 N/A INTRINSIC
low complexity region 3540 3554 N/A INTRINSIC
low complexity region 3794 3822 N/A INTRINSIC
HECTc 4048 4412 4.78e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100769
AA Change: M338T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000098332
Gene: ENSMUSG00000042744
AA Change: M338T

DomainStartEndE-ValueType
coiled coil region 35 61 N/A INTRINSIC
low complexity region 214 225 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
low complexity region 555 567 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Hectd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Hectd4 APN 5 121363870 missense possibly damaging 0.51
IGL00976:Hectd4 APN 5 121349106 missense probably benign 0.18
IGL01085:Hectd4 APN 5 121331701 missense probably damaging 1.00
IGL01112:Hectd4 APN 5 121306950 missense probably benign 0.01
IGL01402:Hectd4 APN 5 121339417 splice site probably benign
IGL01474:Hectd4 APN 5 121336649 missense possibly damaging 0.53
IGL01503:Hectd4 APN 5 121318651 missense probably benign 0.28
IGL01548:Hectd4 APN 5 121364660 missense possibly damaging 0.71
IGL01656:Hectd4 APN 5 121322700 missense probably damaging 0.99
IGL01756:Hectd4 APN 5 121344824 missense probably benign 0.28
IGL01819:Hectd4 APN 5 121328418 missense possibly damaging 0.85
IGL02080:Hectd4 APN 5 121366606 utr 3 prime probably benign
IGL02488:Hectd4 APN 5 121292087 missense probably benign 0.33
IGL02490:Hectd4 APN 5 121318613 missense possibly damaging 0.82
IGL02558:Hectd4 APN 5 121344785 missense probably benign 0.28
IGL02626:Hectd4 APN 5 121353881 missense possibly damaging 0.86
IGL02649:Hectd4 APN 5 121349402 missense possibly damaging 0.73
IGL02736:Hectd4 APN 5 121342719 missense possibly damaging 0.73
IGL02861:Hectd4 APN 5 121307004 missense possibly damaging 0.81
IGL02880:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02889:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02953:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02969:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03031:Hectd4 APN 5 121348794 missense possibly damaging 0.96
IGL03066:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03160:Hectd4 APN 5 121259879 missense probably benign
IGL03181:Hectd4 APN 5 121353958 missense possibly damaging 0.91
IGL03265:Hectd4 APN 5 121259939 splice site probably benign
IGL03375:Hectd4 APN 5 121328382 missense possibly damaging 0.72
PIT4466001:Hectd4 UTSW 5 121333060 critical splice donor site probably null
R0018:Hectd4 UTSW 5 121254179 missense possibly damaging 0.53
R0024:Hectd4 UTSW 5 121308576 missense possibly damaging 0.92
R0030:Hectd4 UTSW 5 121262588 nonsense probably null
R0080:Hectd4 UTSW 5 121349372 missense probably benign 0.18
R0110:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0110:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0115:Hectd4 UTSW 5 121295506 splice site probably benign
R0128:Hectd4 UTSW 5 121349243 missense possibly damaging 0.86
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0132:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0244:Hectd4 UTSW 5 121329605 missense probably benign 0.33
R0281:Hectd4 UTSW 5 121254251 missense possibly damaging 0.85
R0329:Hectd4 UTSW 5 121259864 missense probably benign
R0410:Hectd4 UTSW 5 121286266 missense possibly damaging 0.86
R0422:Hectd4 UTSW 5 121343082 splice site probably null
R0442:Hectd4 UTSW 5 121323982 missense possibly damaging 0.66
R0449:Hectd4 UTSW 5 121364590 synonymous probably null
R0469:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0469:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0481:Hectd4 UTSW 5 121295506 splice site probably benign
R0510:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0510:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0520:Hectd4 UTSW 5 121331707 missense possibly damaging 0.53
R0534:Hectd4 UTSW 5 121348476 missense possibly damaging 0.96
R0603:Hectd4 UTSW 5 121304337 missense possibly damaging 0.46
R0617:Hectd4 UTSW 5 121343232 splice site probably benign
R0622:Hectd4 UTSW 5 121348625 missense possibly damaging 0.53
R0626:Hectd4 UTSW 5 121277824 missense probably benign 0.18
R0708:Hectd4 UTSW 5 121286463 critical splice donor site probably null
R0710:Hectd4 UTSW 5 121336628 missense probably benign 0.08
R0763:Hectd4 UTSW 5 121307033 unclassified probably benign
R0764:Hectd4 UTSW 5 121286769 missense possibly damaging 0.46
R1123:Hectd4 UTSW 5 121286736 missense probably damaging 0.96
R1129:Hectd4 UTSW 5 121310599 missense possibly damaging 0.66
R1204:Hectd4 UTSW 5 121350485 missense possibly damaging 0.85
R1237:Hectd4 UTSW 5 121321507 missense possibly damaging 0.90
R1257:Hectd4 UTSW 5 121318624 nonsense probably null
R1391:Hectd4 UTSW 5 121353695 missense possibly damaging 0.96
R1395:Hectd4 UTSW 5 121328513 critical splice donor site probably null
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1545:Hectd4 UTSW 5 121323956 missense possibly damaging 0.87
R1553:Hectd4 UTSW 5 121349259 missense probably benign 0.00
R1572:Hectd4 UTSW 5 121301878 missense possibly damaging 0.85
R1662:Hectd4 UTSW 5 121317245 missense probably benign 0.01
R1705:Hectd4 UTSW 5 121298104 missense probably benign
R1715:Hectd4 UTSW 5 121344818 missense possibly damaging 0.85
R1728:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1736:Hectd4 UTSW 5 121349530 missense possibly damaging 0.53
R1768:Hectd4 UTSW 5 121358303 missense possibly damaging 0.70
R1775:Hectd4 UTSW 5 121291191 splice site probably benign
R1784:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1843:Hectd4 UTSW 5 121297180 missense possibly damaging 0.53
R1914:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R1915:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R2024:Hectd4 UTSW 5 121281918 missense possibly damaging 0.86
R2103:Hectd4 UTSW 5 121355629 missense probably benign 0.04
R2108:Hectd4 UTSW 5 121333424 missense possibly damaging 0.72
R2124:Hectd4 UTSW 5 121318639 missense probably damaging 0.97
R2150:Hectd4 UTSW 5 121253858 splice site probably benign
R2192:Hectd4 UTSW 5 121315143 missense possibly damaging 0.46
R2301:Hectd4 UTSW 5 121353537 missense probably benign 0.18
R2324:Hectd4 UTSW 5 121315437 missense probably damaging 1.00
R2331:Hectd4 UTSW 5 121320026 missense probably benign 0.05
R2504:Hectd4 UTSW 5 121220620 missense unknown
R2504:Hectd4 UTSW 5 121263967 missense possibly damaging 0.73
R2904:Hectd4 UTSW 5 121292724 splice site probably benign
R3843:Hectd4 UTSW 5 121259873 missense possibly damaging 0.72
R3934:Hectd4 UTSW 5 121320101 critical splice donor site probably null
R3944:Hectd4 UTSW 5 121303525 splice site probably benign
R4133:Hectd4 UTSW 5 121277834 critical splice donor site probably null
R4271:Hectd4 UTSW 5 121220504 small deletion probably benign
R4413:Hectd4 UTSW 5 121350481 missense possibly damaging 0.53
R4456:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R4489:Hectd4 UTSW 5 121286257 missense possibly damaging 0.73
R4539:Hectd4 UTSW 5 121314907 nonsense probably null
R4564:Hectd4 UTSW 5 121350431 missense probably benign 0.33
R4582:Hectd4 UTSW 5 121286419 missense possibly damaging 0.53
R4629:Hectd4 UTSW 5 121297203 missense probably benign 0.01
R4633:Hectd4 UTSW 5 121349216 missense probably benign 0.33
R4643:Hectd4 UTSW 5 121349055 missense possibly damaging 0.53
R4679:Hectd4 UTSW 5 121325251 missense possibly damaging 0.72
R4681:Hectd4 UTSW 5 121303615 missense possibly damaging 0.86
R4734:Hectd4 UTSW 5 121341977 missense possibly damaging 0.53
R4739:Hectd4 UTSW 5 121348442 missense probably benign
R4781:Hectd4 UTSW 5 121306107 critical splice donor site probably null
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4869:Hectd4 UTSW 5 121322672 missense possibly damaging 0.46
R4909:Hectd4 UTSW 5 121263891 missense probably benign 0.18
R4922:Hectd4 UTSW 5 121359315 missense possibly damaging 0.86
R4925:Hectd4 UTSW 5 121322690 missense possibly damaging 0.83
R5004:Hectd4 UTSW 5 121328199 unclassified probably null
R5004:Hectd4 UTSW 5 121329565 missense possibly damaging 0.93
R5129:Hectd4 UTSW 5 121343510 missense possibly damaging 0.87
R5217:Hectd4 UTSW 5 121353551 missense possibly damaging 0.53
R5267:Hectd4 UTSW 5 121344824 missense probably benign 0.28
R5344:Hectd4 UTSW 5 121343676 missense probably benign 0.28
R5345:Hectd4 UTSW 5 121263974 missense possibly damaging 0.85
R5347:Hectd4 UTSW 5 121304448 missense probably benign 0.33
R5360:Hectd4 UTSW 5 121315401 missense possibly damaging 0.90
R5445:Hectd4 UTSW 5 121266274 missense probably benign 0.00
R5479:Hectd4 UTSW 5 121306948 missense probably benign
R5507:Hectd4 UTSW 5 121281101 missense unknown
R5552:Hectd4 UTSW 5 121342851 missense possibly damaging 0.96
R5691:Hectd4 UTSW 5 121348815 missense possibly damaging 0.85
R5745:Hectd4 UTSW 5 121353502 missense possibly damaging 0.96
R5757:Hectd4 UTSW 5 121348619 missense possibly damaging 0.72
R5845:Hectd4 UTSW 5 121307524 critical splice donor site probably null
R5869:Hectd4 UTSW 5 121343225 critical splice donor site probably null
R5913:Hectd4 UTSW 5 121323974 missense possibly damaging 0.83
R5920:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R5943:Hectd4 UTSW 5 121322294 missense probably benign 0.01
R6219:Hectd4 UTSW 5 121308878 missense possibly damaging 0.92
R6250:Hectd4 UTSW 5 121339498 missense possibly damaging 0.85
R6301:Hectd4 UTSW 5 121254220 missense possibly damaging 0.91
R6428:Hectd4 UTSW 5 121350445 missense possibly damaging 0.53
R6446:Hectd4 UTSW 5 121334375 missense possibly damaging 0.86
R6453:Hectd4 UTSW 5 121350592 missense probably damaging 1.00
R6513:Hectd4 UTSW 5 121356196 splice site probably null
R6540:Hectd4 UTSW 5 121303571 missense probably benign 0.33
R6706:Hectd4 UTSW 5 121320084 missense possibly damaging 0.92
R6720:Hectd4 UTSW 5 121307381 nonsense probably null
R6736:Hectd4 UTSW 5 121277725 missense possibly damaging 0.86
R6776:Hectd4 UTSW 5 121353511 missense possibly damaging 0.85
R7033:Hectd4 UTSW 5 121364568 missense possibly damaging 0.86
R7038:Hectd4 UTSW 5 121299597 missense possibly damaging 0.90
R7175:Hectd4 UTSW 5 121273629 missense possibly damaging 0.85
R7180:Hectd4 UTSW 5 121308342 missense probably benign 0.01
R7234:Hectd4 UTSW 5 121329073 missense possibly damaging 0.53
R7253:Hectd4 UTSW 5 121314881 missense possibly damaging 0.66
R7349:Hectd4 UTSW 5 121310663 missense probably damaging 0.97
R7450:Hectd4 UTSW 5 121281932 missense probably benign 0.00
R7467:Hectd4 UTSW 5 121323961 missense possibly damaging 0.66
R7482:Hectd4 UTSW 5 121363878 missense possibly damaging 0.71
R7512:Hectd4 UTSW 5 121297109 missense possibly damaging 0.72
R7525:Hectd4 UTSW 5 121343665 missense possibly damaging 0.70
R7559:Hectd4 UTSW 5 121315510 splice site probably null
R7560:Hectd4 UTSW 5 121254342 missense possibly damaging 0.53
R7561:Hectd4 UTSW 5 121291225 missense possibly damaging 0.91
R7576:Hectd4 UTSW 5 121349459 missense possibly damaging 0.91
R7584:Hectd4 UTSW 5 121318735 missense possibly damaging 0.83
R7648:Hectd4 UTSW 5 121254371 missense possibly damaging 0.73
R7663:Hectd4 UTSW 5 121324031 missense probably benign 0.06
R7692:Hectd4 UTSW 5 121321564 missense possibly damaging 0.46
R7725:Hectd4 UTSW 5 121220617 missense unknown
R7731:Hectd4 UTSW 5 121307014 missense probably benign 0.00
R7732:Hectd4 UTSW 5 121336629 missense probably benign 0.14
R7782:Hectd4 UTSW 5 121305721 missense possibly damaging 0.53
X0026:Hectd4 UTSW 5 121349637 missense probably benign 0.04
X0027:Hectd4 UTSW 5 121321404 missense probably benign 0.27
Z1088:Hectd4 UTSW 5 121295503 splice site probably null
Predicted Primers PCR Primer
(F):5'- TAGCTCCAGATTCTTGGCGC -3'
(R):5'- CTGTGCCTAGTGTGGTGTATACA -3'

Sequencing Primer
(F):5'- CTTGGCGCTGGGCTTCAAAAG -3'
(R):5'- CCCTGGAGTTAGGAACTGAACTC -3'
Posted On2016-08-04