Mutagenetix > Incidental Mutation

Incidental Mutation 'R5363:Sun1'

422925

Institutional Source

Beutler Lab

Gene Symbol

Sun1

Ensembl Gene

ENSMUSG00000036817

Gene Name

Sad1 and UNC84 domain containing 1

Synonyms

Unc84a, 5730434D03Rik, 4632417G13Rik

MMRRC Submission

042941-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5363 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

139200637-139249840 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 139234743 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 410 (N410D)

Ref Sequence

ENSEMBL: ENSMUSP00000106508 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058716] [ENSMUST00000078690] [ENSMUST00000110882] [ENSMUST00000110883] [ENSMUST00000110884] [ENSMUST00000135720]

AlphaFold

Q9D666

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058716
AA Change: N447D

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000056655
Gene: ENSMUSG00000036817
AA Change: N447D

Domain	Start	End	E-Value	Type
low complexity region	23	35	N/A	INTRINSIC
low complexity region	108	127	N/A	INTRINSIC
low complexity region	152	162	N/A	INTRINSIC
ZnF_C2H2	183	205	5.2e0	SMART
SCOP:d1qovm1	334	450	2e-3	SMART
low complexity region	466	475	N/A	INTRINSIC
coiled coil region	492	527	N/A	INTRINSIC
SCOP:d1eq1a_	572	689	3e-3	SMART
Pfam:Sad1_UNC	777	911	2.2e-48	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000078690
AA Change: N383D

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000077756
Gene: ENSMUSG00000036817
AA Change: N383D

Domain	Start	End	E-Value	Type
low complexity region	23	35	N/A	INTRINSIC
low complexity region	108	127	N/A	INTRINSIC
low complexity region	152	162	N/A	INTRINSIC
ZnF_C2H2	183	205	5.2e0	SMART
SCOP:d1qovm1	270	386	2e-3	SMART
low complexity region	402	411	N/A	INTRINSIC
coiled coil region	428	463	N/A	INTRINSIC
SCOP:d1eq1a_	508	625	2e-3	SMART
Pfam:Sad1_UNC	713	847	1.9e-48	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110882
AA Change: N291D

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000106506
Gene: ENSMUSG00000036817
AA Change: N291D

Domain	Start	End	E-Value	Type
low complexity region	23	35	N/A	INTRINSIC
low complexity region	108	127	N/A	INTRINSIC
low complexity region	152	162	N/A	INTRINSIC
ZnF_C2H2	183	205	5.2e0	SMART
low complexity region	263	271	N/A	INTRINSIC
low complexity region	310	319	N/A	INTRINSIC
coiled coil region	336	371	N/A	INTRINSIC
SCOP:d1eq1a_	416	533	4e-3	SMART
Pfam:Sad1_UNC	621	755	7.1e-49	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110883
AA Change: N324D

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000106507
Gene: ENSMUSG00000036817
AA Change: N324D

Domain	Start	End	E-Value	Type
low complexity region	23	35	N/A	INTRINSIC
low complexity region	108	127	N/A	INTRINSIC
low complexity region	152	162	N/A	INTRINSIC
ZnF_C2H2	183	205	5.2e0	SMART
SCOP:d1qovm1	233	327	4e-3	SMART
low complexity region	343	352	N/A	INTRINSIC
coiled coil region	369	404	N/A	INTRINSIC
SCOP:d1eq1a_	449	566	3e-3	SMART
Pfam:Sad1_UNC	654	788	1.7e-48	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110884
AA Change: N410D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000106508
Gene: ENSMUSG00000036817
AA Change: N410D

Domain	Start	End	E-Value	Type
low complexity region	23	35	N/A	INTRINSIC
low complexity region	108	127	N/A	INTRINSIC
low complexity region	152	162	N/A	INTRINSIC
ZnF_C2H2	183	205	5.2e0	SMART
Pfam:MRP	274	381	1.8e-8	PFAM
low complexity region	382	390	N/A	INTRINSIC
low complexity region	429	438	N/A	INTRINSIC
coiled coil region	455	490	N/A	INTRINSIC
SCOP:d1eq1a_	535	652	4e-3	SMART
Pfam:Sad1_UNC	740	874	2e-48	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126108

Predicted Effect

probably benign
Transcript: ENSMUST00000128817

SMART Domains

Protein: ENSMUSP00000119587
Gene: ENSMUSG00000036817

Domain	Start	End	E-Value	Type
coiled coil region	58	126	N/A	INTRINSIC
PDB:4DXS\|A	207	258	1e-13	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000135720

SMART Domains

Protein: ENSMUSP00000122785
Gene: ENSMUSG00000036817

Domain	Start	End	E-Value	Type
low complexity region	14	33	N/A	INTRINSIC
ZnF_C2H2	98	120	5.2e0	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000135926
AA Change: N182D

SMART Domains

Protein: ENSMUSP00000114488
Gene: ENSMUSG00000036817
AA Change: N182D

Domain	Start	End	E-Value	Type
ZnF_C2H2	11	33	5.2e0	SMART
transmembrane domain	59	81	N/A	INTRINSIC
transmembrane domain	120	142	N/A	INTRINSIC
transmembrane domain	149	171	N/A	INTRINSIC
low complexity region	202	211	N/A	INTRINSIC
coiled coil region	227	255	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153469

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the unc-84 homolog family and encodes a nuclear nuclear envelope protein with an Unc84 (SUN) domain. The protein is involved in nuclear anchorage and migration. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit sterility due to arrested meiosis, hearing loss associated with outer hair cell degeneration, abnormal cerebellum development, ataxia, impaired motor coordination, and abnormal Purkinje cell migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Abca1	A	G	4: 53,132,963	I40T	probably benign	Het
Abca13	T	C	11: 9,277,035	V597A	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc1	A	G	2: 128,650,194		probably null	Het
Ap4e1	G	A	2: 127,037,864		probably null	Het
Apod	T	C	16: 31,311,091	T16A	probably benign	Het
Arrdc5	C	T	17: 56,300,138	V36M	probably damaging	Het
Bcan	A	G	3: 87,995,487	V328A	probably damaging	Het
Bche	A	G	3: 73,700,639	Y485H	probably damaging	Het
Btbd6	A	G	12: 112,978,136	Y356C	probably damaging	Het
Cdh4	A	G	2: 179,886,763	T555A	probably benign	Het
Ciita	C	T	16: 10,512,167	H769Y	probably damaging	Het
Clspn	A	G	4: 126,561,786	D35G	possibly damaging	Het
Cpsf3	T	A	12: 21,308,985	M562K	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cyp2a22	T	A	7: 26,936,433	Q235L	probably damaging	Het
Dicer1	A	G	12: 104,703,151	S1091P	probably damaging	Het
Dync1li1	T	A	9: 114,715,229	I323N	probably damaging	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat4	A	G	3: 38,888,005	N349S	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Hectd4	T	C	5: 121,310,603	M338T	probably benign	Het
Lactb2	A	T	1: 13,630,132	I225N	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mrps30	A	G	13: 118,387,162	S25P	probably benign	Het
Myg1	T	C	15: 102,337,824	V378A	probably benign	Het
Notch4	C	T	17: 34,587,123	T1731I	probably damaging	Het
Ntmt1	A	G	2: 30,820,648	D121G	probably damaging	Het
Olfr1167	A	T	2: 88,149,802	D72E	probably damaging	Het
Olfr763	C	A	10: 129,011,914	P210T	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pclo	A	G	5: 14,669,410	D1187G	unknown	Het
Pkd1	T	A	17: 24,565,073	Y198N	probably benign	Het
Plk4	T	A	3: 40,801,984	N83K	possibly damaging	Het
Prune2	A	T	19: 17,118,266	Q378L	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rasa1	G	T	13: 85,288,555	T118K	possibly damaging	Het
Rin3	G	A	12: 102,325,834	V97M	probably damaging	Het
Rock2	T	C	12: 16,965,654		probably null	Het
Slc34a1	A	G	13: 55,403,268	I289V	probably benign	Het
Slc34a1	T	C	13: 55,412,290	L443P	probably damaging	Het
Slco2a1	A	T	9: 103,070,263	I254F	probably damaging	Het
Spink11	T	C	18: 44,195,686	I32V	probably benign	Het
Spire1	T	C	18: 67,506,555	E296G	probably damaging	Het
Syt14	T	A	1: 192,930,663	T610S	possibly damaging	Het
Tenm3	T	C	8: 48,287,831	I1206V	possibly damaging	Het
Tet3	A	T	6: 83,376,764		probably null	Het
Thbs1	A	T	2: 118,122,666	Q919L	probably damaging	Het
Trappc10	A	G	10: 78,188,840	F1152L	possibly damaging	Het
Trp63	C	A	16: 25,863,718	N176K	probably damaging	Het
Zbtb17	A	G	4: 141,466,761	E700G	probably benign	Het
Zfp446	G	A	7: 12,978,057	R69H	probably benign	Het
Zfy2	C	T	Y: 2,106,555	C693Y	possibly damaging	Het
Zxdc	A	G	6: 90,382,146	T587A	probably damaging	Het
Zyg11a	A	G	4: 108,189,622	C552R	probably damaging	Het

Other mutations in Sun1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Sun1	APN	5	139234685	critical splice acceptor site	probably null
IGL01364:Sun1	APN	5	139234741	missense	probably damaging	1.00
IGL02142:Sun1	APN	5	139231163	missense	possibly damaging	0.95
IGL02251:Sun1	APN	5	139241431	missense	probably damaging	1.00
IGL02939:Sun1	APN	5	139235488	splice site	probably benign
IGL03253:Sun1	APN	5	139223586	splice site	probably benign
IGL03370:Sun1	APN	5	139231131	missense	probably damaging	0.96
PIT4418001:Sun1	UTSW	5	139226588	missense	probably damaging	0.97
R0124:Sun1	UTSW	5	139246679	unclassified	probably benign
R0145:Sun1	UTSW	5	139241411	missense	probably damaging	0.98
R0376:Sun1	UTSW	5	139226699	unclassified	probably benign
R0512:Sun1	UTSW	5	139234847	splice site	probably benign
R0729:Sun1	UTSW	5	139237864	unclassified	probably benign
R0733:Sun1	UTSW	5	139231163	missense	possibly damaging	0.63
R1188:Sun1	UTSW	5	139238856	missense	probably damaging	0.98
R1724:Sun1	UTSW	5	139235725	missense	probably benign
R1733:Sun1	UTSW	5	139230789	missense	possibly damaging	0.82
R1913:Sun1	UTSW	5	139235732	critical splice donor site	probably null
R2033:Sun1	UTSW	5	139225438	missense	probably damaging	1.00
R2200:Sun1	UTSW	5	139231219	missense	probably benign	0.11
R3084:Sun1	UTSW	5	139235601	missense	probably benign	0.41
R3085:Sun1	UTSW	5	139235601	missense	probably benign	0.41
R3771:Sun1	UTSW	5	139238820	unclassified	probably benign
R3772:Sun1	UTSW	5	139238820	unclassified	probably benign
R3804:Sun1	UTSW	5	139225362	nonsense	probably null
R4300:Sun1	UTSW	5	139227594	unclassified	probably benign
R4428:Sun1	UTSW	5	139234475	intron	probably benign
R4993:Sun1	UTSW	5	139225333	missense	possibly damaging	0.84
R5075:Sun1	UTSW	5	139226891	splice site	probably null
R5826:Sun1	UTSW	5	139245416	missense	probably damaging	1.00
R6753:Sun1	UTSW	5	139215259	splice site	probably null
R7218:Sun1	UTSW	5	139226687	missense	unknown
R7320:Sun1	UTSW	5	139248484	missense	probably damaging	1.00
R7448:Sun1	UTSW	5	139246834	missense	probably damaging	1.00
R7494:Sun1	UTSW	5	139235720	missense	probably benign
R8398:Sun1	UTSW	5	139236653	missense	probably damaging	1.00
R8756:Sun1	UTSW	5	139236689	missense	probably damaging	0.99
R8772:Sun1	UTSW	5	139223692	missense	probably benign	0.00
R8804:Sun1	UTSW	5	139231165	missense	probably benign	0.05
R8924:Sun1	UTSW	5	139223635	missense	probably damaging	1.00
R9124:Sun1	UTSW	5	139245366	nonsense	probably null
R9169:Sun1	UTSW	5	139233518	missense	probably benign	0.33
R9262:Sun1	UTSW	5	139215163	missense	unknown
R9558:Sun1	UTSW	5	139225264	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGGTGCCTTCGAAATATTTGC -3'
(R):5'- GATTGGCTGTTCAAAAGTGGC -3'

Sequencing Primer
(F):5'- CCTACTTTTACTAGGTAAGACATGGC -3'
(R):5'- CTGTTCAAAAGTGGCATGAAAAGC -3'

Posted On

2016-08-04