Incidental Mutation 'R5363:Sun1'
ID 422925
Institutional Source Beutler Lab
Gene Symbol Sun1
Ensembl Gene ENSMUSG00000036817
Gene Name Sad1 and UNC84 domain containing 1
Synonyms 4632417G13Rik, 5730434D03Rik, Unc84a
MMRRC Submission 042941-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5363 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 139186392-139235595 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 139220498 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 410 (N410D)
Ref Sequence ENSEMBL: ENSMUSP00000106508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058716] [ENSMUST00000078690] [ENSMUST00000110882] [ENSMUST00000110883] [ENSMUST00000110884] [ENSMUST00000135720]
AlphaFold Q9D666
Predicted Effect possibly damaging
Transcript: ENSMUST00000058716
AA Change: N447D

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056655
Gene: ENSMUSG00000036817
AA Change: N447D

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 334 450 2e-3 SMART
low complexity region 466 475 N/A INTRINSIC
coiled coil region 492 527 N/A INTRINSIC
SCOP:d1eq1a_ 572 689 3e-3 SMART
Pfam:Sad1_UNC 777 911 2.2e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078690
AA Change: N383D

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077756
Gene: ENSMUSG00000036817
AA Change: N383D

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 270 386 2e-3 SMART
low complexity region 402 411 N/A INTRINSIC
coiled coil region 428 463 N/A INTRINSIC
SCOP:d1eq1a_ 508 625 2e-3 SMART
Pfam:Sad1_UNC 713 847 1.9e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110882
AA Change: N291D

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106506
Gene: ENSMUSG00000036817
AA Change: N291D

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
low complexity region 263 271 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
coiled coil region 336 371 N/A INTRINSIC
SCOP:d1eq1a_ 416 533 4e-3 SMART
Pfam:Sad1_UNC 621 755 7.1e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110883
AA Change: N324D

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106507
Gene: ENSMUSG00000036817
AA Change: N324D

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 233 327 4e-3 SMART
low complexity region 343 352 N/A INTRINSIC
coiled coil region 369 404 N/A INTRINSIC
SCOP:d1eq1a_ 449 566 3e-3 SMART
Pfam:Sad1_UNC 654 788 1.7e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110884
AA Change: N410D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106508
Gene: ENSMUSG00000036817
AA Change: N410D

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
Pfam:MRP 274 381 1.8e-8 PFAM
low complexity region 382 390 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
coiled coil region 455 490 N/A INTRINSIC
SCOP:d1eq1a_ 535 652 4e-3 SMART
Pfam:Sad1_UNC 740 874 2e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126108
Predicted Effect probably benign
Transcript: ENSMUST00000128817
SMART Domains Protein: ENSMUSP00000119587
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
coiled coil region 58 126 N/A INTRINSIC
PDB:4DXS|A 207 258 1e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000135720
SMART Domains Protein: ENSMUSP00000122785
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
ZnF_C2H2 98 120 5.2e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000135926
AA Change: N182D
SMART Domains Protein: ENSMUSP00000114488
Gene: ENSMUSG00000036817
AA Change: N182D

DomainStartEndE-ValueType
ZnF_C2H2 11 33 5.2e0 SMART
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 202 211 N/A INTRINSIC
coiled coil region 227 255 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153469
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the unc-84 homolog family and encodes a nuclear nuclear envelope protein with an Unc84 (SUN) domain. The protein is involved in nuclear anchorage and migration. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit sterility due to arrested meiosis, hearing loss associated with outer hair cell degeneration, abnormal cerebellum development, ataxia, impaired motor coordination, and abnormal Purkinje cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,132,963 (GRCm39) I40T probably benign Het
Abca13 T C 11: 9,227,035 (GRCm39) V597A possibly damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Anapc1 A G 2: 128,492,114 (GRCm39) probably null Het
Ap4e1 G A 2: 126,879,784 (GRCm39) probably null Het
Apod T C 16: 31,129,909 (GRCm39) T16A probably benign Het
Arrdc5 C T 17: 56,607,138 (GRCm39) V36M probably damaging Het
Bcan A G 3: 87,902,794 (GRCm39) V328A probably damaging Het
Bche A G 3: 73,607,972 (GRCm39) Y485H probably damaging Het
Btbd6 A G 12: 112,941,756 (GRCm39) Y356C probably damaging Het
Cdh4 A G 2: 179,528,556 (GRCm39) T555A probably benign Het
Ciita C T 16: 10,330,031 (GRCm39) H769Y probably damaging Het
Clspn A G 4: 126,455,579 (GRCm39) D35G possibly damaging Het
Cpsf3 T A 12: 21,358,986 (GRCm39) M562K probably benign Het
Cstdc1 G T 2: 148,625,298 (GRCm39) L77F probably damaging Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,759,803 (GRCm39) probably null Het
Cyp2a22 T A 7: 26,635,858 (GRCm39) Q235L probably damaging Het
Dicer1 A G 12: 104,669,410 (GRCm39) S1091P probably damaging Het
Dync1li1 T A 9: 114,544,297 (GRCm39) I323N probably damaging Het
Fat4 A G 3: 38,942,154 (GRCm39) N349S probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Hectd4 T C 5: 121,448,666 (GRCm39) M338T probably benign Het
Insyn2b G A 11: 34,352,788 (GRCm39) E277K probably damaging Het
Lactb2 A T 1: 13,700,356 (GRCm39) I225N probably benign Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Mrps30 A G 13: 118,523,698 (GRCm39) S25P probably benign Het
Myg1 T C 15: 102,246,259 (GRCm39) V378A probably benign Het
Notch4 C T 17: 34,806,097 (GRCm39) T1731I probably damaging Het
Ntmt1 A G 2: 30,710,660 (GRCm39) D121G probably damaging Het
Or10p21 C A 10: 128,847,783 (GRCm39) P210T probably damaging Het
Or5d39 A T 2: 87,980,146 (GRCm39) D72E probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pclo A G 5: 14,719,424 (GRCm39) D1187G unknown Het
Pkd1 T A 17: 24,784,047 (GRCm39) Y198N probably benign Het
Plk4 T A 3: 40,756,419 (GRCm39) N83K possibly damaging Het
Prune2 A T 19: 17,095,630 (GRCm39) Q378L probably damaging Het
R3hdm4 C T 10: 79,748,292 (GRCm39) E162K possibly damaging Het
Rasa1 G T 13: 85,436,674 (GRCm39) T118K possibly damaging Het
Rin3 G A 12: 102,292,093 (GRCm39) V97M probably damaging Het
Rock2 T C 12: 17,015,655 (GRCm39) probably null Het
Slc34a1 A G 13: 55,551,081 (GRCm39) I289V probably benign Het
Slc34a1 T C 13: 55,560,103 (GRCm39) L443P probably damaging Het
Slco2a1 A T 9: 102,947,462 (GRCm39) I254F probably damaging Het
Spink11 T C 18: 44,328,753 (GRCm39) I32V probably benign Het
Spire1 T C 18: 67,639,625 (GRCm39) E296G probably damaging Het
Syt14 T A 1: 192,612,971 (GRCm39) T610S possibly damaging Het
Tenm3 T C 8: 48,740,866 (GRCm39) I1206V possibly damaging Het
Tet3 A T 6: 83,353,746 (GRCm39) probably null Het
Thbs1 A T 2: 117,953,147 (GRCm39) Q919L probably damaging Het
Trappc10 A G 10: 78,024,674 (GRCm39) F1152L possibly damaging Het
Trp63 C A 16: 25,682,468 (GRCm39) N176K probably damaging Het
Zbtb17 A G 4: 141,194,072 (GRCm39) E700G probably benign Het
Zfp446 G A 7: 12,711,984 (GRCm39) R69H probably benign Het
Zfy2 C T Y: 2,106,555 (GRCm39) C693Y possibly damaging Het
Zxdc A G 6: 90,359,128 (GRCm39) T587A probably damaging Het
Zyg11a A G 4: 108,046,819 (GRCm39) C552R probably damaging Het
Other mutations in Sun1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Sun1 APN 5 139,220,440 (GRCm39) critical splice acceptor site probably null
IGL01364:Sun1 APN 5 139,220,496 (GRCm39) missense probably damaging 1.00
IGL02142:Sun1 APN 5 139,216,918 (GRCm39) missense possibly damaging 0.95
IGL02251:Sun1 APN 5 139,227,186 (GRCm39) missense probably damaging 1.00
IGL02939:Sun1 APN 5 139,221,243 (GRCm39) splice site probably benign
IGL03253:Sun1 APN 5 139,209,341 (GRCm39) splice site probably benign
IGL03370:Sun1 APN 5 139,216,886 (GRCm39) missense probably damaging 0.96
PIT4418001:Sun1 UTSW 5 139,212,343 (GRCm39) missense probably damaging 0.97
R0124:Sun1 UTSW 5 139,232,434 (GRCm39) unclassified probably benign
R0145:Sun1 UTSW 5 139,227,166 (GRCm39) missense probably damaging 0.98
R0376:Sun1 UTSW 5 139,212,454 (GRCm39) unclassified probably benign
R0512:Sun1 UTSW 5 139,220,602 (GRCm39) splice site probably benign
R0729:Sun1 UTSW 5 139,223,619 (GRCm39) unclassified probably benign
R0733:Sun1 UTSW 5 139,216,918 (GRCm39) missense possibly damaging 0.63
R1188:Sun1 UTSW 5 139,224,611 (GRCm39) missense probably damaging 0.98
R1724:Sun1 UTSW 5 139,221,480 (GRCm39) missense probably benign
R1733:Sun1 UTSW 5 139,216,544 (GRCm39) missense possibly damaging 0.82
R1913:Sun1 UTSW 5 139,221,487 (GRCm39) critical splice donor site probably null
R2033:Sun1 UTSW 5 139,211,193 (GRCm39) missense probably damaging 1.00
R2200:Sun1 UTSW 5 139,216,974 (GRCm39) missense probably benign 0.11
R3084:Sun1 UTSW 5 139,221,356 (GRCm39) missense probably benign 0.41
R3085:Sun1 UTSW 5 139,221,356 (GRCm39) missense probably benign 0.41
R3771:Sun1 UTSW 5 139,224,575 (GRCm39) unclassified probably benign
R3772:Sun1 UTSW 5 139,224,575 (GRCm39) unclassified probably benign
R3804:Sun1 UTSW 5 139,211,117 (GRCm39) nonsense probably null
R4300:Sun1 UTSW 5 139,213,349 (GRCm39) unclassified probably benign
R4428:Sun1 UTSW 5 139,220,230 (GRCm39) intron probably benign
R4993:Sun1 UTSW 5 139,211,088 (GRCm39) missense possibly damaging 0.84
R5075:Sun1 UTSW 5 139,212,646 (GRCm39) splice site probably null
R5826:Sun1 UTSW 5 139,231,171 (GRCm39) missense probably damaging 1.00
R6753:Sun1 UTSW 5 139,201,014 (GRCm39) splice site probably null
R7218:Sun1 UTSW 5 139,212,442 (GRCm39) missense unknown
R7320:Sun1 UTSW 5 139,234,239 (GRCm39) missense probably damaging 1.00
R7448:Sun1 UTSW 5 139,232,589 (GRCm39) missense probably damaging 1.00
R7494:Sun1 UTSW 5 139,221,475 (GRCm39) missense probably benign
R8398:Sun1 UTSW 5 139,222,408 (GRCm39) missense probably damaging 1.00
R8756:Sun1 UTSW 5 139,222,444 (GRCm39) missense probably damaging 0.99
R8772:Sun1 UTSW 5 139,209,447 (GRCm39) missense probably benign 0.00
R8804:Sun1 UTSW 5 139,216,920 (GRCm39) missense probably benign 0.05
R8924:Sun1 UTSW 5 139,209,390 (GRCm39) missense probably damaging 1.00
R9124:Sun1 UTSW 5 139,231,121 (GRCm39) nonsense probably null
R9169:Sun1 UTSW 5 139,219,273 (GRCm39) missense probably benign 0.33
R9262:Sun1 UTSW 5 139,200,918 (GRCm39) missense unknown
R9558:Sun1 UTSW 5 139,211,019 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTGCCTTCGAAATATTTGC -3'
(R):5'- GATTGGCTGTTCAAAAGTGGC -3'

Sequencing Primer
(F):5'- CCTACTTTTACTAGGTAAGACATGGC -3'
(R):5'- CTGTTCAAAAGTGGCATGAAAAGC -3'
Posted On 2016-08-04