Incidental Mutation 'R5363:Tet3'
ID422927
Institutional Source Beutler Lab
Gene Symbol Tet3
Ensembl Gene ENSMUSG00000034832
Gene Nametet methylcytosine dioxygenase 3
SynonymsD230004J03Rik, B430006D22Rik
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.636) question?
Stock #R5363 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83362373-83459084 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 83376764 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089622] [ENSMUST00000186548]
Predicted Effect probably null
Transcript: ENSMUST00000089622
SMART Domains Protein: ENSMUSP00000087049
Gene: ENSMUSG00000034832

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
low complexity region 66 77 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
internal_repeat_1 160 277 4.9e-5 PROSPERO
low complexity region 279 297 N/A INTRINSIC
low complexity region 359 371 N/A INTRINSIC
low complexity region 418 456 N/A INTRINSIC
Tet_JBP 858 1570 N/A SMART
coiled coil region 1579 1603 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000186548
SMART Domains Protein: ENSMUSP00000139630
Gene: ENSMUSG00000034832

DomainStartEndE-ValueType
Pfam:zf-CXXC 49 89 8e-6 PFAM
low complexity region 162 173 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
internal_repeat_1 295 412 5.5e-5 PROSPERO
low complexity region 414 432 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
low complexity region 553 591 N/A INTRINSIC
Tet_JBP 993 1705 N/A SMART
coiled coil region 1714 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the ten-eleven translocation (TET) gene family, including TET3, play a role in the DNA methylation process (Langemeijer et al., 2009 [PubMed 19923888]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice inheriting a null allele from a germ cell conditional null mother display impaired reprogramming of the paternal genome resulting in reduced embryo viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Tet3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Tet3 APN 6 83368655 missense probably benign 0.06
IGL01396:Tet3 APN 6 83369638 nonsense probably null
IGL02344:Tet3 APN 6 83403833 missense probably benign 0.04
IGL02987:Tet3 APN 6 83368092 missense probably damaging 0.99
IGL03126:Tet3 APN 6 83376787 missense probably damaging 1.00
IGL03155:Tet3 APN 6 83368383 missense probably damaging 1.00
IGL03286:Tet3 APN 6 83375778 missense probably damaging 1.00
Reedy UTSW 6 83368084 nonsense probably null
P0033:Tet3 UTSW 6 83368512 missense probably damaging 1.00
R0131:Tet3 UTSW 6 83368788 missense probably damaging 1.00
R0295:Tet3 UTSW 6 83369139 missense probably benign 0.14
R0504:Tet3 UTSW 6 83373794 missense probably damaging 1.00
R0524:Tet3 UTSW 6 83379942 missense probably damaging 1.00
R1061:Tet3 UTSW 6 83373323 missense probably damaging 0.99
R1160:Tet3 UTSW 6 83404452 missense probably benign 0.00
R1550:Tet3 UTSW 6 83386028 missense probably damaging 0.97
R1640:Tet3 UTSW 6 83369315 missense probably benign 0.44
R1658:Tet3 UTSW 6 83369057 missense probably benign 0.44
R1746:Tet3 UTSW 6 83368068 missense probably damaging 1.00
R1761:Tet3 UTSW 6 83403659 missense probably damaging 0.99
R1832:Tet3 UTSW 6 83403645 missense probably benign
R1835:Tet3 UTSW 6 83404163 missense possibly damaging 0.95
R1932:Tet3 UTSW 6 83404379 missense possibly damaging 0.94
R2014:Tet3 UTSW 6 83386075 missense probably damaging 1.00
R2230:Tet3 UTSW 6 83369471 missense probably damaging 1.00
R2232:Tet3 UTSW 6 83369471 missense probably damaging 1.00
R2922:Tet3 UTSW 6 83368512 missense probably damaging 1.00
R3429:Tet3 UTSW 6 83403419 missense probably damaging 1.00
R3430:Tet3 UTSW 6 83403419 missense probably damaging 1.00
R4291:Tet3 UTSW 6 83373199 missense probably damaging 1.00
R4349:Tet3 UTSW 6 83403275 missense probably benign
R4809:Tet3 UTSW 6 83402946 missense probably benign
R4846:Tet3 UTSW 6 83376883 nonsense probably null
R5039:Tet3 UTSW 6 83375896 missense probably damaging 1.00
R5233:Tet3 UTSW 6 83386063 missense probably damaging 1.00
R5880:Tet3 UTSW 6 83370550 missense probably damaging 1.00
R6270:Tet3 UTSW 6 83375791 missense possibly damaging 0.86
R6277:Tet3 UTSW 6 83368084 nonsense probably null
R6564:Tet3 UTSW 6 83386070 missense possibly damaging 0.92
R6622:Tet3 UTSW 6 83403444 missense probably benign 0.00
R7089:Tet3 UTSW 6 83455024 missense possibly damaging 0.46
R7244:Tet3 UTSW 6 83370621 missense probably damaging 1.00
R7251:Tet3 UTSW 6 83404056 missense probably benign
R7361:Tet3 UTSW 6 83368094 missense probably benign 0.15
R7436:Tet3 UTSW 6 83368229 small insertion probably benign
R7438:Tet3 UTSW 6 83368229 small insertion probably benign
R7544:Tet3 UTSW 6 83404641 missense probably damaging 1.00
R7552:Tet3 UTSW 6 83368307 missense probably damaging 1.00
R7942:Tet3 UTSW 6 83376974 missense probably damaging 1.00
R8010:Tet3 UTSW 6 83403246 missense unknown
R8063:Tet3 UTSW 6 83402741 missense probably damaging 1.00
R8307:Tet3 UTSW 6 83379927 missense probably damaging 1.00
R9016:Tet3 UTSW 6 83368271 missense probably damaging 1.00
R9020:Tet3 UTSW 6 83404436 missense probably damaging 1.00
X0004:Tet3 UTSW 6 83403423 missense probably benign 0.17
Z1176:Tet3 UTSW 6 83370698 missense probably damaging 1.00
Z1176:Tet3 UTSW 6 83404350 missense probably damaging 1.00
Z1176:Tet3 UTSW 6 83459021 missense unknown
Z1177:Tet3 UTSW 6 83404294 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCCTCCAAGCTATATGCCGAAAG -3'
(R):5'- CAGGTGATCCGAAGACACAC -3'

Sequencing Primer
(F):5'- AGGGTAACTTTACTGAAACTAATTGC -3'
(R):5'- AGAAGCTGCTGTGCCTG -3'
Posted On2016-08-04