Mutagenetix > Incidental Mutation

Incidental Mutation 'R5363:Tet3'

422927

Institutional Source

Beutler Lab

Gene Symbol

Tet3

Ensembl Gene

ENSMUSG00000034832

Gene Name

tet methylcytosine dioxygenase 3

Synonyms

D230004J03Rik, B430006D22Rik

MMRRC Submission

042941-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.567) question?

Stock #

R5363 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83362373-83459084 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 83376764 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000139630 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089622] [ENSMUST00000186548]

AlphaFold

Q8BG87

Predicted Effect

probably null
Transcript: ENSMUST00000089622

SMART Domains

Protein: ENSMUSP00000087049
Gene: ENSMUSG00000034832

Domain	Start	End	E-Value	Type
low complexity region	27	38	N/A	INTRINSIC
low complexity region	66	77	N/A	INTRINSIC
low complexity region	115	126	N/A	INTRINSIC
internal_repeat_1	160	277	4.9e-5	PROSPERO
low complexity region	279	297	N/A	INTRINSIC
low complexity region	359	371	N/A	INTRINSIC
low complexity region	418	456	N/A	INTRINSIC
Tet_JBP	858	1570	N/A	SMART
coiled coil region	1579	1603	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000186548

SMART Domains

Protein: ENSMUSP00000139630
Gene: ENSMUSG00000034832

Domain	Start	End	E-Value	Type
Pfam:zf-CXXC	49	89	8e-6	PFAM
low complexity region	162	173	N/A	INTRINSIC
low complexity region	201	212	N/A	INTRINSIC
low complexity region	250	261	N/A	INTRINSIC
internal_repeat_1	295	412	5.5e-5	PROSPERO
low complexity region	414	432	N/A	INTRINSIC
low complexity region	494	506	N/A	INTRINSIC
low complexity region	553	591	N/A	INTRINSIC
Tet_JBP	993	1705	N/A	SMART
coiled coil region	1714	1738	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the ten-eleven translocation (TET) gene family, including TET3, play a role in the DNA methylation process (Langemeijer et al., 2009 [PubMed 19923888]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice inheriting a null allele from a germ cell conditional null mother display impaired reprogramming of the paternal genome resulting in reduced embryo viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Abca1	A	G	4: 53,132,963	I40T	probably benign	Het
Abca13	T	C	11: 9,277,035	V597A	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc1	A	G	2: 128,650,194		probably null	Het
Ap4e1	G	A	2: 127,037,864		probably null	Het
Apod	T	C	16: 31,311,091	T16A	probably benign	Het
Arrdc5	C	T	17: 56,300,138	V36M	probably damaging	Het
Bcan	A	G	3: 87,995,487	V328A	probably damaging	Het
Bche	A	G	3: 73,700,639	Y485H	probably damaging	Het
Btbd6	A	G	12: 112,978,136	Y356C	probably damaging	Het
Cdh4	A	G	2: 179,886,763	T555A	probably benign	Het
Ciita	C	T	16: 10,512,167	H769Y	probably damaging	Het
Clspn	A	G	4: 126,561,786	D35G	possibly damaging	Het
Cpsf3	T	A	12: 21,308,985	M562K	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cyp2a22	T	A	7: 26,936,433	Q235L	probably damaging	Het
Dicer1	A	G	12: 104,703,151	S1091P	probably damaging	Het
Dync1li1	T	A	9: 114,715,229	I323N	probably damaging	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat4	A	G	3: 38,888,005	N349S	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Hectd4	T	C	5: 121,310,603	M338T	probably benign	Het
Lactb2	A	T	1: 13,630,132	I225N	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mrps30	A	G	13: 118,387,162	S25P	probably benign	Het
Myg1	T	C	15: 102,337,824	V378A	probably benign	Het
Notch4	C	T	17: 34,587,123	T1731I	probably damaging	Het
Ntmt1	A	G	2: 30,820,648	D121G	probably damaging	Het
Olfr1167	A	T	2: 88,149,802	D72E	probably damaging	Het
Olfr763	C	A	10: 129,011,914	P210T	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pclo	A	G	5: 14,669,410	D1187G	unknown	Het
Pkd1	T	A	17: 24,565,073	Y198N	probably benign	Het
Plk4	T	A	3: 40,801,984	N83K	possibly damaging	Het
Prune2	A	T	19: 17,118,266	Q378L	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rasa1	G	T	13: 85,288,555	T118K	possibly damaging	Het
Rin3	G	A	12: 102,325,834	V97M	probably damaging	Het
Rock2	T	C	12: 16,965,654		probably null	Het
Slc34a1	A	G	13: 55,403,268	I289V	probably benign	Het
Slc34a1	T	C	13: 55,412,290	L443P	probably damaging	Het
Slco2a1	A	T	9: 103,070,263	I254F	probably damaging	Het
Spink11	T	C	18: 44,195,686	I32V	probably benign	Het
Spire1	T	C	18: 67,506,555	E296G	probably damaging	Het
Sun1	A	G	5: 139,234,743	N410D	probably damaging	Het
Syt14	T	A	1: 192,930,663	T610S	possibly damaging	Het
Tenm3	T	C	8: 48,287,831	I1206V	possibly damaging	Het
Thbs1	A	T	2: 118,122,666	Q919L	probably damaging	Het
Trappc10	A	G	10: 78,188,840	F1152L	possibly damaging	Het
Trp63	C	A	16: 25,863,718	N176K	probably damaging	Het
Zbtb17	A	G	4: 141,466,761	E700G	probably benign	Het
Zfp446	G	A	7: 12,978,057	R69H	probably benign	Het
Zfy2	C	T	Y: 2,106,555	C693Y	possibly damaging	Het
Zxdc	A	G	6: 90,382,146	T587A	probably damaging	Het
Zyg11a	A	G	4: 108,189,622	C552R	probably damaging	Het

Other mutations in Tet3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00929:Tet3	APN	6	83368655	missense	probably benign	0.06
IGL01396:Tet3	APN	6	83369638	nonsense	probably null
IGL02344:Tet3	APN	6	83403833	missense	probably benign	0.04
IGL02987:Tet3	APN	6	83368092	missense	probably damaging	0.99
IGL03126:Tet3	APN	6	83376787	missense	probably damaging	1.00
IGL03155:Tet3	APN	6	83368383	missense	probably damaging	1.00
IGL03286:Tet3	APN	6	83375778	missense	probably damaging	1.00
Reedy	UTSW	6	83368084	nonsense	probably null
P0033:Tet3	UTSW	6	83368512	missense	probably damaging	1.00
R0131:Tet3	UTSW	6	83368788	missense	probably damaging	1.00
R0295:Tet3	UTSW	6	83369139	missense	probably benign	0.14
R0504:Tet3	UTSW	6	83373794	missense	probably damaging	1.00
R0524:Tet3	UTSW	6	83379942	missense	probably damaging	1.00
R1061:Tet3	UTSW	6	83373323	missense	probably damaging	0.99
R1160:Tet3	UTSW	6	83404452	missense	probably benign	0.00
R1550:Tet3	UTSW	6	83386028	missense	probably damaging	0.97
R1640:Tet3	UTSW	6	83369315	missense	probably benign	0.44
R1658:Tet3	UTSW	6	83369057	missense	probably benign	0.44
R1746:Tet3	UTSW	6	83368068	missense	probably damaging	1.00
R1761:Tet3	UTSW	6	83403659	missense	probably damaging	0.99
R1832:Tet3	UTSW	6	83403645	missense	probably benign
R1835:Tet3	UTSW	6	83404163	missense	possibly damaging	0.95
R1932:Tet3	UTSW	6	83404379	missense	possibly damaging	0.94
R2014:Tet3	UTSW	6	83386075	missense	probably damaging	1.00
R2230:Tet3	UTSW	6	83369471	missense	probably damaging	1.00
R2232:Tet3	UTSW	6	83369471	missense	probably damaging	1.00
R2922:Tet3	UTSW	6	83368512	missense	probably damaging	1.00
R3429:Tet3	UTSW	6	83403419	missense	probably damaging	1.00
R3430:Tet3	UTSW	6	83403419	missense	probably damaging	1.00
R4291:Tet3	UTSW	6	83373199	missense	probably damaging	1.00
R4349:Tet3	UTSW	6	83403275	missense	probably benign
R4809:Tet3	UTSW	6	83402946	missense	probably benign
R4846:Tet3	UTSW	6	83376883	nonsense	probably null
R5039:Tet3	UTSW	6	83375896	missense	probably damaging	1.00
R5233:Tet3	UTSW	6	83386063	missense	probably damaging	1.00
R5880:Tet3	UTSW	6	83370550	missense	probably damaging	1.00
R6270:Tet3	UTSW	6	83375791	missense	possibly damaging	0.86
R6277:Tet3	UTSW	6	83368084	nonsense	probably null
R6564:Tet3	UTSW	6	83386070	missense	possibly damaging	0.92
R6622:Tet3	UTSW	6	83403444	missense	probably benign	0.00
R7089:Tet3	UTSW	6	83455024	missense	possibly damaging	0.46
R7244:Tet3	UTSW	6	83370621	missense	probably damaging	1.00
R7251:Tet3	UTSW	6	83404056	missense	probably benign
R7361:Tet3	UTSW	6	83368094	missense	probably benign	0.15
R7436:Tet3	UTSW	6	83368229	small insertion	probably benign
R7438:Tet3	UTSW	6	83368229	small insertion	probably benign
R7544:Tet3	UTSW	6	83404641	missense	probably damaging	1.00
R7552:Tet3	UTSW	6	83368307	missense	probably damaging	1.00
R7942:Tet3	UTSW	6	83376974	missense	probably damaging	1.00
R8010:Tet3	UTSW	6	83403246	missense	unknown
R8063:Tet3	UTSW	6	83402741	missense	probably damaging	1.00
R8307:Tet3	UTSW	6	83379927	missense	probably damaging	1.00
R9016:Tet3	UTSW	6	83368271	missense	probably damaging	1.00
R9020:Tet3	UTSW	6	83404436	missense	probably damaging	1.00
R9377:Tet3	UTSW	6	83403614	missense	possibly damaging	0.95
R9476:Tet3	UTSW	6	83403953	missense	possibly damaging	0.91
R9476:Tet3	UTSW	6	83404826	critical splice acceptor site	probably null
R9510:Tet3	UTSW	6	83403953	missense	possibly damaging	0.91
R9510:Tet3	UTSW	6	83404826	critical splice acceptor site	probably null
R9582:Tet3	UTSW	6	83404244	missense	probably damaging	0.99
R9671:Tet3	UTSW	6	83404154	missense	possibly damaging	0.89
R9801:Tet3	UTSW	6	83369454	missense	possibly damaging	0.94
X0004:Tet3	UTSW	6	83403423	missense	probably benign	0.17
Z1176:Tet3	UTSW	6	83370698	missense	probably damaging	1.00
Z1176:Tet3	UTSW	6	83404350	missense	probably damaging	1.00
Z1176:Tet3	UTSW	6	83459021	missense	unknown
Z1177:Tet3	UTSW	6	83404294	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- TCCTCCAAGCTATATGCCGAAAG -3'
(R):5'- CAGGTGATCCGAAGACACAC -3'

Sequencing Primer
(F):5'- AGGGTAACTTTACTGAAACTAATTGC -3'
(R):5'- AGAAGCTGCTGTGCCTG -3'

Posted On

2016-08-04