Incidental Mutation 'R5363:Zfp446'
ID 422930
Institutional Source Beutler Lab
Gene Symbol Zfp446
Ensembl Gene ENSMUSG00000033961
Gene Name zinc finger protein 446
Synonyms A630035I11Rik
MMRRC Submission 042941-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R5363 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 12711726-12718323 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 12711984 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 69 (R69H)
Ref Sequence ENSEMBL: ENSMUSP00000039073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038701] [ENSMUST00000045810] [ENSMUST00000108535] [ENSMUST00000108536] [ENSMUST00000108537] [ENSMUST00000124387] [ENSMUST00000128293]
AlphaFold Q8C9M8
Predicted Effect probably benign
Transcript: ENSMUST00000038701
SMART Domains Protein: ENSMUSP00000041944
Gene: ENSMUSG00000004500

DomainStartEndE-ValueType
KRAB 31 91 8.89e-30 SMART
ZnF_C2H2 291 313 2.95e-3 SMART
ZnF_C2H2 319 341 1.82e-3 SMART
ZnF_C2H2 347 369 6.88e-4 SMART
ZnF_C2H2 375 397 1.95e-3 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 453 2.95e-3 SMART
ZnF_C2H2 459 481 2.75e-3 SMART
ZnF_C2H2 487 509 1.25e-1 SMART
ZnF_C2H2 515 537 7.37e-4 SMART
low complexity region 564 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045810
AA Change: R69H

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039073
Gene: ENSMUSG00000033961
AA Change: R69H

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
SCAN 122 234 1.29e-53 SMART
KRAB 299 360 3.96e-2 SMART
ZnF_C2H2 419 441 2.95e-3 SMART
ZnF_C2H2 468 490 8.47e-4 SMART
ZnF_C2H2 496 518 5.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108535
SMART Domains Protein: ENSMUSP00000104175
Gene: ENSMUSG00000033961

DomainStartEndE-ValueType
SCAN 22 134 1.29e-53 SMART
KRAB 199 254 1.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108536
SMART Domains Protein: ENSMUSP00000104176
Gene: ENSMUSG00000033961

DomainStartEndE-ValueType
SCAN 22 134 1.29e-53 SMART
KRAB 199 260 3.96e-2 SMART
ZnF_C2H2 319 341 2.95e-3 SMART
ZnF_C2H2 368 390 8.47e-4 SMART
ZnF_C2H2 396 418 5.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108537
SMART Domains Protein: ENSMUSP00000104177
Gene: ENSMUSG00000033961

DomainStartEndE-ValueType
SCAN 22 128 7.37e-49 SMART
KRAB 124 185 3.96e-2 SMART
ZnF_C2H2 244 266 2.95e-3 SMART
ZnF_C2H2 293 315 8.47e-4 SMART
ZnF_C2H2 321 343 5.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124387
Predicted Effect probably benign
Transcript: ENSMUST00000128293
SMART Domains Protein: ENSMUSP00000124620
Gene: ENSMUSG00000004500

DomainStartEndE-ValueType
KRAB 31 75 3.83e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147996
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,132,963 (GRCm39) I40T probably benign Het
Abca13 T C 11: 9,227,035 (GRCm39) V597A possibly damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Anapc1 A G 2: 128,492,114 (GRCm39) probably null Het
Ap4e1 G A 2: 126,879,784 (GRCm39) probably null Het
Apod T C 16: 31,129,909 (GRCm39) T16A probably benign Het
Arrdc5 C T 17: 56,607,138 (GRCm39) V36M probably damaging Het
Bcan A G 3: 87,902,794 (GRCm39) V328A probably damaging Het
Bche A G 3: 73,607,972 (GRCm39) Y485H probably damaging Het
Btbd6 A G 12: 112,941,756 (GRCm39) Y356C probably damaging Het
Cdh4 A G 2: 179,528,556 (GRCm39) T555A probably benign Het
Ciita C T 16: 10,330,031 (GRCm39) H769Y probably damaging Het
Clspn A G 4: 126,455,579 (GRCm39) D35G possibly damaging Het
Cpsf3 T A 12: 21,358,986 (GRCm39) M562K probably benign Het
Cstdc1 G T 2: 148,625,298 (GRCm39) L77F probably damaging Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,759,803 (GRCm39) probably null Het
Cyp2a22 T A 7: 26,635,858 (GRCm39) Q235L probably damaging Het
Dicer1 A G 12: 104,669,410 (GRCm39) S1091P probably damaging Het
Dync1li1 T A 9: 114,544,297 (GRCm39) I323N probably damaging Het
Fat4 A G 3: 38,942,154 (GRCm39) N349S probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Hectd4 T C 5: 121,448,666 (GRCm39) M338T probably benign Het
Insyn2b G A 11: 34,352,788 (GRCm39) E277K probably damaging Het
Lactb2 A T 1: 13,700,356 (GRCm39) I225N probably benign Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Mrps30 A G 13: 118,523,698 (GRCm39) S25P probably benign Het
Myg1 T C 15: 102,246,259 (GRCm39) V378A probably benign Het
Notch4 C T 17: 34,806,097 (GRCm39) T1731I probably damaging Het
Ntmt1 A G 2: 30,710,660 (GRCm39) D121G probably damaging Het
Or10p21 C A 10: 128,847,783 (GRCm39) P210T probably damaging Het
Or5d39 A T 2: 87,980,146 (GRCm39) D72E probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pclo A G 5: 14,719,424 (GRCm39) D1187G unknown Het
Pkd1 T A 17: 24,784,047 (GRCm39) Y198N probably benign Het
Plk4 T A 3: 40,756,419 (GRCm39) N83K possibly damaging Het
Prune2 A T 19: 17,095,630 (GRCm39) Q378L probably damaging Het
R3hdm4 C T 10: 79,748,292 (GRCm39) E162K possibly damaging Het
Rasa1 G T 13: 85,436,674 (GRCm39) T118K possibly damaging Het
Rin3 G A 12: 102,292,093 (GRCm39) V97M probably damaging Het
Rock2 T C 12: 17,015,655 (GRCm39) probably null Het
Slc34a1 A G 13: 55,551,081 (GRCm39) I289V probably benign Het
Slc34a1 T C 13: 55,560,103 (GRCm39) L443P probably damaging Het
Slco2a1 A T 9: 102,947,462 (GRCm39) I254F probably damaging Het
Spink11 T C 18: 44,328,753 (GRCm39) I32V probably benign Het
Spire1 T C 18: 67,639,625 (GRCm39) E296G probably damaging Het
Sun1 A G 5: 139,220,498 (GRCm39) N410D probably damaging Het
Syt14 T A 1: 192,612,971 (GRCm39) T610S possibly damaging Het
Tenm3 T C 8: 48,740,866 (GRCm39) I1206V possibly damaging Het
Tet3 A T 6: 83,353,746 (GRCm39) probably null Het
Thbs1 A T 2: 117,953,147 (GRCm39) Q919L probably damaging Het
Trappc10 A G 10: 78,024,674 (GRCm39) F1152L possibly damaging Het
Trp63 C A 16: 25,682,468 (GRCm39) N176K probably damaging Het
Zbtb17 A G 4: 141,194,072 (GRCm39) E700G probably benign Het
Zfy2 C T Y: 2,106,555 (GRCm39) C693Y possibly damaging Het
Zxdc A G 6: 90,359,128 (GRCm39) T587A probably damaging Het
Zyg11a A G 4: 108,046,819 (GRCm39) C552R probably damaging Het
Other mutations in Zfp446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Zfp446 APN 7 12,713,307 (GRCm39) critical splice donor site probably null
IGL01534:Zfp446 APN 7 12,713,493 (GRCm39) missense probably damaging 1.00
IGL02471:Zfp446 APN 7 12,716,181 (GRCm39) missense probably benign 0.41
IGL02888:Zfp446 APN 7 12,713,255 (GRCm39) missense probably damaging 1.00
IGL03153:Zfp446 APN 7 12,711,834 (GRCm39) missense probably benign 0.01
IGL03185:Zfp446 APN 7 12,712,925 (GRCm39) missense probably null 0.43
IGL03242:Zfp446 APN 7 12,713,252 (GRCm39) missense probably damaging 1.00
R0538:Zfp446 UTSW 7 12,713,516 (GRCm39) missense possibly damaging 0.94
R1809:Zfp446 UTSW 7 12,713,048 (GRCm39) missense probably damaging 1.00
R3686:Zfp446 UTSW 7 12,716,580 (GRCm39) missense probably damaging 0.97
R3701:Zfp446 UTSW 7 12,712,079 (GRCm39) unclassified probably benign
R5256:Zfp446 UTSW 7 12,713,231 (GRCm39) nonsense probably null
R5377:Zfp446 UTSW 7 12,716,178 (GRCm39) missense possibly damaging 0.88
R6806:Zfp446 UTSW 7 12,713,043 (GRCm39) missense probably damaging 1.00
R7167:Zfp446 UTSW 7 12,712,049 (GRCm39) unclassified probably benign
R7988:Zfp446 UTSW 7 12,712,970 (GRCm39) missense possibly damaging 0.93
R8288:Zfp446 UTSW 7 12,711,885 (GRCm39) missense probably benign 0.00
R8487:Zfp446 UTSW 7 12,716,555 (GRCm39) missense possibly damaging 0.68
R8943:Zfp446 UTSW 7 12,713,564 (GRCm39) nonsense probably null
R9315:Zfp446 UTSW 7 12,713,397 (GRCm39) missense probably benign 0.28
Z1177:Zfp446 UTSW 7 12,712,093 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTAAGGAGGCTAACCCACAGTC -3'
(R):5'- AGCCGGATTATGAAGCTGC -3'

Sequencing Primer
(F):5'- GCTAACCCACAGTCGGCTC -3'
(R):5'- ATTATGAAGCTGCGCCCG -3'
Posted On 2016-08-04