Incidental Mutation 'R5363:Zfp446'
ID422930
Institutional Source Beutler Lab
Gene Symbol Zfp446
Ensembl Gene ENSMUSG00000033961
Gene Namezinc finger protein 446
Synonyms
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5363 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12977848-12985714 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12978057 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 69 (R69H)
Ref Sequence ENSEMBL: ENSMUSP00000039073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038701] [ENSMUST00000045810] [ENSMUST00000108535] [ENSMUST00000108536] [ENSMUST00000108537] [ENSMUST00000124387] [ENSMUST00000128293]
Predicted Effect probably benign
Transcript: ENSMUST00000038701
SMART Domains Protein: ENSMUSP00000041944
Gene: ENSMUSG00000004500

DomainStartEndE-ValueType
KRAB 31 91 8.89e-30 SMART
ZnF_C2H2 291 313 2.95e-3 SMART
ZnF_C2H2 319 341 1.82e-3 SMART
ZnF_C2H2 347 369 6.88e-4 SMART
ZnF_C2H2 375 397 1.95e-3 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 453 2.95e-3 SMART
ZnF_C2H2 459 481 2.75e-3 SMART
ZnF_C2H2 487 509 1.25e-1 SMART
ZnF_C2H2 515 537 7.37e-4 SMART
low complexity region 564 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045810
AA Change: R69H

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039073
Gene: ENSMUSG00000033961
AA Change: R69H

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
SCAN 122 234 1.29e-53 SMART
KRAB 299 360 3.96e-2 SMART
ZnF_C2H2 419 441 2.95e-3 SMART
ZnF_C2H2 468 490 8.47e-4 SMART
ZnF_C2H2 496 518 5.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108535
SMART Domains Protein: ENSMUSP00000104175
Gene: ENSMUSG00000033961

DomainStartEndE-ValueType
SCAN 22 134 1.29e-53 SMART
KRAB 199 254 1.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108536
SMART Domains Protein: ENSMUSP00000104176
Gene: ENSMUSG00000033961

DomainStartEndE-ValueType
SCAN 22 134 1.29e-53 SMART
KRAB 199 260 3.96e-2 SMART
ZnF_C2H2 319 341 2.95e-3 SMART
ZnF_C2H2 368 390 8.47e-4 SMART
ZnF_C2H2 396 418 5.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108537
SMART Domains Protein: ENSMUSP00000104177
Gene: ENSMUSG00000033961

DomainStartEndE-ValueType
SCAN 22 128 7.37e-49 SMART
KRAB 124 185 3.96e-2 SMART
ZnF_C2H2 244 266 2.95e-3 SMART
ZnF_C2H2 293 315 8.47e-4 SMART
ZnF_C2H2 321 343 5.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124387
Predicted Effect probably benign
Transcript: ENSMUST00000128293
SMART Domains Protein: ENSMUSP00000124620
Gene: ENSMUSG00000004500

DomainStartEndE-ValueType
KRAB 31 75 3.83e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147996
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Zfp446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Zfp446 APN 7 12979380 critical splice donor site probably null
IGL01534:Zfp446 APN 7 12979566 missense probably damaging 1.00
IGL02471:Zfp446 APN 7 12982254 missense probably benign 0.41
IGL02888:Zfp446 APN 7 12979328 missense probably damaging 1.00
IGL03153:Zfp446 APN 7 12977907 missense probably benign 0.01
IGL03185:Zfp446 APN 7 12978998 missense probably null 0.43
IGL03242:Zfp446 APN 7 12979325 missense probably damaging 1.00
R0538:Zfp446 UTSW 7 12979589 missense possibly damaging 0.94
R1809:Zfp446 UTSW 7 12979121 missense probably damaging 1.00
R3686:Zfp446 UTSW 7 12982653 missense probably damaging 0.97
R3701:Zfp446 UTSW 7 12978152 unclassified probably benign
R5256:Zfp446 UTSW 7 12979304 nonsense probably null
R5377:Zfp446 UTSW 7 12982251 missense possibly damaging 0.88
R6806:Zfp446 UTSW 7 12979116 missense probably damaging 1.00
R7167:Zfp446 UTSW 7 12978122 unclassified probably benign
R7988:Zfp446 UTSW 7 12979043 missense possibly damaging 0.93
R8288:Zfp446 UTSW 7 12977958 missense probably benign 0.00
Z1177:Zfp446 UTSW 7 12978166 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTAAGGAGGCTAACCCACAGTC -3'
(R):5'- AGCCGGATTATGAAGCTGC -3'

Sequencing Primer
(F):5'- GCTAACCCACAGTCGGCTC -3'
(R):5'- ATTATGAAGCTGCGCCCG -3'
Posted On2016-08-04