Incidental Mutation 'R5363:Cyp2a22'
ID422931
Institutional Source Beutler Lab
Gene Symbol Cyp2a22
Ensembl Gene ENSMUSG00000091867
Gene Namecytochrome P450, family 2, subfamily a, polypeptide 22
SynonymsEG233005
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5363 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location26931631-26939384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26936433 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 235 (Q235L)
Ref Sequence ENSEMBL: ENSMUSP00000128030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170227]
Predicted Effect probably damaging
Transcript: ENSMUST00000170227
AA Change: Q235L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128030
Gene: ENSMUSG00000091867
AA Change: Q235L

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:p450 33 489 7.4e-148 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206957
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Cyp2a22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Cyp2a22 APN 7 26937738 missense probably benign 0.09
IGL01111:Cyp2a22 APN 7 26936458 missense probably damaging 1.00
IGL01388:Cyp2a22 APN 7 26937792 missense probably benign 0.02
IGL01449:Cyp2a22 APN 7 26933553 missense probably benign 0.01
IGL01642:Cyp2a22 APN 7 26938759 missense possibly damaging 0.81
IGL02253:Cyp2a22 APN 7 26938237 splice site probably benign
IGL02327:Cyp2a22 APN 7 26934781 missense probably damaging 0.99
IGL02673:Cyp2a22 APN 7 26938100 missense probably benign 0.00
IGL02813:Cyp2a22 APN 7 26936434 missense probably benign 0.19
IGL02896:Cyp2a22 APN 7 26936461 missense probably damaging 0.98
IGL03193:Cyp2a22 APN 7 26936421 missense probably benign 0.00
IGL03350:Cyp2a22 APN 7 26934854 missense possibly damaging 0.88
R1648:Cyp2a22 UTSW 7 26932368 missense probably damaging 0.98
R1679:Cyp2a22 UTSW 7 26936311 nonsense probably null
R1733:Cyp2a22 UTSW 7 26934762 missense possibly damaging 0.78
R2001:Cyp2a22 UTSW 7 26934772 missense probably damaging 1.00
R2858:Cyp2a22 UTSW 7 26934262 missense probably damaging 0.99
R3054:Cyp2a22 UTSW 7 26938829 missense probably damaging 1.00
R4528:Cyp2a22 UTSW 7 26934769 missense possibly damaging 0.95
R4623:Cyp2a22 UTSW 7 26933491 missense probably damaging 1.00
R4669:Cyp2a22 UTSW 7 26937855 missense possibly damaging 0.88
R4690:Cyp2a22 UTSW 7 26939209 nonsense probably null
R4840:Cyp2a22 UTSW 7 26932524 missense probably benign 0.13
R4915:Cyp2a22 UTSW 7 26937770 missense probably benign 0.33
R5071:Cyp2a22 UTSW 7 26932481 missense probably benign 0.01
R5072:Cyp2a22 UTSW 7 26932481 missense probably benign 0.01
R5074:Cyp2a22 UTSW 7 26932481 missense probably benign 0.01
R5147:Cyp2a22 UTSW 7 26936325 missense probably damaging 1.00
R5705:Cyp2a22 UTSW 7 26939215 missense probably benign 0.05
R6014:Cyp2a22 UTSW 7 26939180 splice site probably null
R6042:Cyp2a22 UTSW 7 26934239 missense probably damaging 1.00
R6253:Cyp2a22 UTSW 7 26934232 missense probably benign 0.18
R6757:Cyp2a22 UTSW 7 26939204 missense probably benign 0.00
R6994:Cyp2a22 UTSW 7 26939181 critical splice donor site probably null
R7581:Cyp2a22 UTSW 7 26938148 missense possibly damaging 0.87
R8212:Cyp2a22 UTSW 7 26937780 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ATCATGGGGACTTAATGGACCTC -3'
(R):5'- GCTGTTTATTGTAATCCAGCCTCAC -3'

Sequencing Primer
(F):5'- GGGACTTAATGGACCTCTGTTCC -3'
(R):5'- GCCTCACATACATACATTAGTACATG -3'
Posted On2016-08-04