Incidental Mutation 'R5363:Slco2a1'
ID422934
Institutional Source Beutler Lab
Gene Symbol Slco2a1
Ensembl Gene ENSMUSG00000032548
Gene Namesolute carrier organic anion transporter family, member 2a1
SynonymsPgt, mPgt, 2310021C19Rik, Slc21a2
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5363 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location102988712-103096002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103070263 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 254 (I254F)
Ref Sequence ENSEMBL: ENSMUSP00000140533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035148] [ENSMUST00000188664]
Predicted Effect probably damaging
Transcript: ENSMUST00000035148
AA Change: I254F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035148
Gene: ENSMUSG00000032548
AA Change: I254F

DomainStartEndE-ValueType
Pfam:MFS_1 39 428 3.5e-22 PFAM
KAZAL 446 493 2.78e-2 SMART
transmembrane domain 605 627 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188664
AA Change: I254F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140533
Gene: ENSMUSG00000032548
AA Change: I254F

DomainStartEndE-ValueType
Pfam:OATP 31 381 4.8e-135 PFAM
Pfam:MFS_1 39 413 1.8e-19 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a prostaglandin transporter that is a member of the 12-membrane-spanning superfamily of transporters. The encoded protein may be involved in mediating the uptake and clearance of prostaglandins in numerous tissues. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preinatel or early psotnatal lethality due to a patent ductus arteriosus and abnormal protaglandin metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Slco2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Slco2a1 APN 9 103079441 splice site probably benign
IGL01481:Slco2a1 APN 9 103070251 missense probably damaging 1.00
IGL01647:Slco2a1 APN 9 103070296 missense possibly damaging 0.57
IGL01885:Slco2a1 APN 9 103074430 missense probably damaging 1.00
IGL02150:Slco2a1 APN 9 103084818 missense probably damaging 1.00
IGL02508:Slco2a1 APN 9 103074416 missense probably benign
IGL02578:Slco2a1 APN 9 103046758 missense probably damaging 1.00
IGL02622:Slco2a1 APN 9 103076929 nonsense probably null
IGL02898:Slco2a1 APN 9 103079606 missense probably damaging 1.00
IGL03101:Slco2a1 APN 9 103077006 missense possibly damaging 0.69
PIT4431001:Slco2a1 UTSW 9 103050268 missense probably damaging 1.00
R0410:Slco2a1 UTSW 9 103073314 critical splice donor site probably null
R0831:Slco2a1 UTSW 9 103082334 missense probably damaging 0.99
R0885:Slco2a1 UTSW 9 103082383 missense probably damaging 0.98
R1975:Slco2a1 UTSW 9 103079454 nonsense probably null
R2095:Slco2a1 UTSW 9 103076968 missense probably benign 0.22
R4072:Slco2a1 UTSW 9 103068002 missense probably damaging 1.00
R4105:Slco2a1 UTSW 9 103067876 missense probably benign 0.01
R4105:Slco2a1 UTSW 9 103073250 missense probably damaging 1.00
R4804:Slco2a1 UTSW 9 103073184 missense probably damaging 1.00
R4881:Slco2a1 UTSW 9 103085832 missense possibly damaging 0.71
R5073:Slco2a1 UTSW 9 103046726 missense probably damaging 1.00
R5124:Slco2a1 UTSW 9 103050166 missense probably damaging 1.00
R5147:Slco2a1 UTSW 9 103050269 missense probably damaging 1.00
R5317:Slco2a1 UTSW 9 103079579 missense probably benign 0.01
R5381:Slco2a1 UTSW 9 103068014 missense probably damaging 1.00
R5732:Slco2a1 UTSW 9 103050256 missense probably damaging 1.00
R5736:Slco2a1 UTSW 9 103067830 missense probably benign 0.00
R5924:Slco2a1 UTSW 9 103046699 nonsense probably null
R5945:Slco2a1 UTSW 9 103046790 missense probably damaging 1.00
R6293:Slco2a1 UTSW 9 103050147 missense probably benign 0.30
R6386:Slco2a1 UTSW 9 103076988 missense probably benign
R6622:Slco2a1 UTSW 9 103074505 missense possibly damaging 0.84
R7325:Slco2a1 UTSW 9 103085749 splice site probably null
R7484:Slco2a1 UTSW 9 103067986 missense probably damaging 1.00
R8395:Slco2a1 UTSW 9 103077040 missense probably benign 0.12
R8985:Slco2a1 UTSW 9 103072635 critical splice donor site probably null
Z1088:Slco2a1 UTSW 9 103079527 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCCTGCCAAGAGCTAGAGAG -3'
(R):5'- TTCCAAGCCCGTGTCCATTG -3'

Sequencing Primer
(F):5'- AGCATTTGCCTTCTGTGCAGAG -3'
(R):5'- GCTTACGTGGCTACATCCATGG -3'
Posted On2016-08-04