Incidental Mutation 'R5363:Trappc10'
ID422935
Institutional Source Beutler Lab
Gene Symbol Trappc10
Ensembl Gene ENSMUSG00000000374
Gene Nametrafficking protein particle complex 10
SynonymsTmem1, LOC380642, B230307C21Rik
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5363 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location78186725-78244641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78188840 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1152 (F1152L)
Ref Sequence ENSEMBL: ENSMUSP00000000384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000384] [ENSMUST00000042556]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000384
AA Change: F1152L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000384
Gene: ENSMUSG00000000374
AA Change: F1152L

DomainStartEndE-ValueType
Pfam:TRAPPC10 1016 1245 1.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042556
SMART Domains Protein: ENSMUSP00000045812
Gene: ENSMUSG00000032834

DomainStartEndE-ValueType
WD40 43 83 1.47e2 SMART
WD40 86 123 1.78e1 SMART
WD40 133 172 5.35e-1 SMART
WD40 177 216 8.29e-1 SMART
low complexity region 239 254 N/A INTRINSIC
WD40 273 316 1.9e2 SMART
WD40 319 359 4.44e0 SMART
WD40 362 401 7.44e-8 SMART
WD40 404 443 3.87e-6 SMART
WD40 446 487 5.7e1 SMART
WD40 490 529 1.28e-11 SMART
WD40 533 571 9.94e-1 SMART
WD40 594 633 4.95e0 SMART
WD40 692 729 2.21e1 SMART
Pfam:Utp12 771 875 9.4e-25 PFAM
low complexity region 890 902 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219948
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane protein found in the cis-Golgi complex. The encoded protein is part of the multisubunit transport protein particle (TRAPP) complex and may be involved in vesicular transport from the endoplasmic reticulum to the Golgi. Mutations in this gene could be responsible for the Unverricht-Lundborg type of progressive myoclonus epilepsy, or for autoimmune polyglandular disease type 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cardiovascular phenotypes, including atrioventricular or ventricular septal defects, thymus hypoplasia, and eye defects such as microphthalmia or anophthalmia. Holoprosencephaly, anencephaly and severe craniofacial defects may be also present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Trappc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Trappc10 APN 10 78203877 splice site probably benign
IGL01375:Trappc10 APN 10 78188899 missense possibly damaging 0.75
IGL01413:Trappc10 APN 10 78197844 missense possibly damaging 0.87
IGL02413:Trappc10 APN 10 78210776 missense probably damaging 0.99
IGL03037:Trappc10 APN 10 78199035 unclassified probably benign
IGL03094:Trappc10 APN 10 78228920 splice site probably benign
IGL03164:Trappc10 APN 10 78220242 missense probably damaging 1.00
IGL03351:Trappc10 APN 10 78188761 missense probably damaging 1.00
IGL03055:Trappc10 UTSW 10 78214686 missense probably damaging 1.00
IGL03098:Trappc10 UTSW 10 78214686 missense probably damaging 1.00
R0304:Trappc10 UTSW 10 78210760 splice site probably benign
R0605:Trappc10 UTSW 10 78201497 missense possibly damaging 0.70
R1806:Trappc10 UTSW 10 78210776 missense probably damaging 0.99
R1856:Trappc10 UTSW 10 78196451 missense probably benign 0.00
R2045:Trappc10 UTSW 10 78209479 splice site probably benign
R2088:Trappc10 UTSW 10 78196334 missense probably benign 0.00
R2126:Trappc10 UTSW 10 78203924 missense possibly damaging 0.94
R2202:Trappc10 UTSW 10 78199042 critical splice donor site probably null
R2509:Trappc10 UTSW 10 78211523 missense possibly damaging 0.51
R2510:Trappc10 UTSW 10 78211523 missense possibly damaging 0.51
R2511:Trappc10 UTSW 10 78211523 missense possibly damaging 0.51
R2893:Trappc10 UTSW 10 78193401 missense probably benign 0.00
R3744:Trappc10 UTSW 10 78199090 missense probably benign 0.00
R3778:Trappc10 UTSW 10 78200802 missense possibly damaging 0.89
R3876:Trappc10 UTSW 10 78220186 splice site probably null
R3930:Trappc10 UTSW 10 78210403 missense probably benign 0.03
R4078:Trappc10 UTSW 10 78210382 missense probably damaging 1.00
R4111:Trappc10 UTSW 10 78196430 missense probably benign 0.09
R4418:Trappc10 UTSW 10 78217188 missense probably damaging 1.00
R4549:Trappc10 UTSW 10 78231458 missense probably damaging 1.00
R4695:Trappc10 UTSW 10 78197863 missense probably damaging 0.99
R4799:Trappc10 UTSW 10 78201590 missense possibly damaging 0.71
R5022:Trappc10 UTSW 10 78217160 missense possibly damaging 0.72
R5023:Trappc10 UTSW 10 78217160 missense possibly damaging 0.72
R5026:Trappc10 UTSW 10 78204288 missense possibly damaging 0.82
R5057:Trappc10 UTSW 10 78217160 missense possibly damaging 0.72
R5282:Trappc10 UTSW 10 78187860 missense probably damaging 1.00
R5813:Trappc10 UTSW 10 78222739 missense probably damaging 1.00
R5831:Trappc10 UTSW 10 78209426 missense probably damaging 1.00
R6209:Trappc10 UTSW 10 78214812 missense possibly damaging 0.50
R6450:Trappc10 UTSW 10 78209450 missense possibly damaging 0.92
R6520:Trappc10 UTSW 10 78201453 missense probably benign 0.00
R6533:Trappc10 UTSW 10 78188894 missense probably damaging 0.96
R6767:Trappc10 UTSW 10 78193511 missense possibly damaging 0.75
R6798:Trappc10 UTSW 10 78188831 missense probably benign 0.00
R7205:Trappc10 UTSW 10 78210428 missense probably damaging 1.00
R7282:Trappc10 UTSW 10 78207493 missense probably damaging 0.98
R7378:Trappc10 UTSW 10 78193418 missense probably damaging 0.96
R7384:Trappc10 UTSW 10 78209384 missense possibly damaging 0.85
R7770:Trappc10 UTSW 10 78210845 missense probably damaging 0.96
R7829:Trappc10 UTSW 10 78199075 missense probably benign
R7839:Trappc10 UTSW 10 78188812 missense possibly damaging 0.84
R8298:Trappc10 UTSW 10 78202919 missense probably damaging 1.00
R8306:Trappc10 UTSW 10 78200626 missense possibly damaging 0.54
Z1177:Trappc10 UTSW 10 78217153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGCAATGAGTGAACTGAAC -3'
(R):5'- ACTTAACTTGAAGCGTGTGTG -3'

Sequencing Primer
(F):5'- CTGAACTTCAGTACTTCTAACATGAG -3'
(R):5'- AACTTGAAGCGTGTGTGTCCTATAG -3'
Posted On2016-08-04