Mutagenetix > Incidental Mutation

Incidental Mutation 'R5363:Trappc10'

422935

Institutional Source

Beutler Lab

Gene Symbol

Trappc10

Ensembl Gene

ENSMUSG00000000374

Gene Name

trafficking protein particle complex 10

Synonyms

Tmem1, LOC380642, B230307C21Rik

MMRRC Submission

042941-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5363 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

78186725-78244641 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 78188840 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1152 (F1152L)

Ref Sequence

ENSEMBL: ENSMUSP00000000384 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000384] [ENSMUST00000042556]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000000384
AA Change: F1152L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000000384
Gene: ENSMUSG00000000374
AA Change: F1152L

Domain	Start	End	E-Value	Type
Pfam:TRAPPC10	1016	1245	1.1e-45	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000042556

SMART Domains

Protein: ENSMUSP00000045812
Gene: ENSMUSG00000032834

Domain	Start	End	E-Value	Type
WD40	43	83	1.47e2	SMART
WD40	86	123	1.78e1	SMART
WD40	133	172	5.35e-1	SMART
WD40	177	216	8.29e-1	SMART
low complexity region	239	254	N/A	INTRINSIC
WD40	273	316	1.9e2	SMART
WD40	319	359	4.44e0	SMART
WD40	362	401	7.44e-8	SMART
WD40	404	443	3.87e-6	SMART
WD40	446	487	5.7e1	SMART
WD40	490	529	1.28e-11	SMART
WD40	533	571	9.94e-1	SMART
WD40	594	633	4.95e0	SMART
WD40	692	729	2.21e1	SMART
Pfam:Utp12	771	875	9.4e-25	PFAM
low complexity region	890	902	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219948

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane protein found in the cis-Golgi complex. The encoded protein is part of the multisubunit transport protein particle (TRAPP) complex and may be involved in vesicular transport from the endoplasmic reticulum to the Golgi. Mutations in this gene could be responsible for the Unverricht-Lundborg type of progressive myoclonus epilepsy, or for autoimmune polyglandular disease type 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cardiovascular phenotypes, including atrioventricular or ventricular septal defects, thymus hypoplasia, and eye defects such as microphthalmia or anophthalmia. Holoprosencephaly, anencephaly and severe craniofacial defects may be also present. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Abca1	A	G	4: 53,132,963	I40T	probably benign	Het
Abca13	T	C	11: 9,277,035	V597A	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc1	A	G	2: 128,650,194		probably null	Het
Ap4e1	G	A	2: 127,037,864		probably null	Het
Apod	T	C	16: 31,311,091	T16A	probably benign	Het
Arrdc5	C	T	17: 56,300,138	V36M	probably damaging	Het
Bcan	A	G	3: 87,995,487	V328A	probably damaging	Het
Bche	A	G	3: 73,700,639	Y485H	probably damaging	Het
Btbd6	A	G	12: 112,978,136	Y356C	probably damaging	Het
Cdh4	A	G	2: 179,886,763	T555A	probably benign	Het
Ciita	C	T	16: 10,512,167	H769Y	probably damaging	Het
Clspn	A	G	4: 126,561,786	D35G	possibly damaging	Het
Cpsf3	T	A	12: 21,308,985	M562K	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cyp2a22	T	A	7: 26,936,433	Q235L	probably damaging	Het
Dicer1	A	G	12: 104,703,151	S1091P	probably damaging	Het
Dync1li1	T	A	9: 114,715,229	I323N	probably damaging	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat4	A	G	3: 38,888,005	N349S	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Hectd4	T	C	5: 121,310,603	M338T	probably benign	Het
Lactb2	A	T	1: 13,630,132	I225N	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mrps30	A	G	13: 118,387,162	S25P	probably benign	Het
Myg1	T	C	15: 102,337,824	V378A	probably benign	Het
Notch4	C	T	17: 34,587,123	T1731I	probably damaging	Het
Ntmt1	A	G	2: 30,820,648	D121G	probably damaging	Het
Olfr1167	A	T	2: 88,149,802	D72E	probably damaging	Het
Olfr763	C	A	10: 129,011,914	P210T	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pclo	A	G	5: 14,669,410	D1187G	unknown	Het
Pkd1	T	A	17: 24,565,073	Y198N	probably benign	Het
Plk4	T	A	3: 40,801,984	N83K	possibly damaging	Het
Prune2	A	T	19: 17,118,266	Q378L	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rasa1	G	T	13: 85,288,555	T118K	possibly damaging	Het
Rin3	G	A	12: 102,325,834	V97M	probably damaging	Het
Rock2	T	C	12: 16,965,654		probably null	Het
Slc34a1	A	G	13: 55,403,268	I289V	probably benign	Het
Slc34a1	T	C	13: 55,412,290	L443P	probably damaging	Het
Slco2a1	A	T	9: 103,070,263	I254F	probably damaging	Het
Spink11	T	C	18: 44,195,686	I32V	probably benign	Het
Spire1	T	C	18: 67,506,555	E296G	probably damaging	Het
Sun1	A	G	5: 139,234,743	N410D	probably damaging	Het
Syt14	T	A	1: 192,930,663	T610S	possibly damaging	Het
Tenm3	T	C	8: 48,287,831	I1206V	possibly damaging	Het
Tet3	A	T	6: 83,376,764		probably null	Het
Thbs1	A	T	2: 118,122,666	Q919L	probably damaging	Het
Trp63	C	A	16: 25,863,718	N176K	probably damaging	Het
Zbtb17	A	G	4: 141,466,761	E700G	probably benign	Het
Zfp446	G	A	7: 12,978,057	R69H	probably benign	Het
Zfy2	C	T	Y: 2,106,555	C693Y	possibly damaging	Het
Zxdc	A	G	6: 90,382,146	T587A	probably damaging	Het
Zyg11a	A	G	4: 108,189,622	C552R	probably damaging	Het

Other mutations in Trappc10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Trappc10	APN	10	78203877	splice site	probably benign
IGL01375:Trappc10	APN	10	78188899	missense	possibly damaging	0.75
IGL01413:Trappc10	APN	10	78197844	missense	possibly damaging	0.87
IGL02413:Trappc10	APN	10	78210776	missense	probably damaging	0.99
IGL03037:Trappc10	APN	10	78199035	unclassified	probably benign
IGL03094:Trappc10	APN	10	78228920	splice site	probably benign
IGL03164:Trappc10	APN	10	78220242	missense	probably damaging	1.00
IGL03351:Trappc10	APN	10	78188761	missense	probably damaging	1.00
IGL03055:Trappc10	UTSW	10	78214686	missense	probably damaging	1.00
IGL03098:Trappc10	UTSW	10	78214686	missense	probably damaging	1.00
R0304:Trappc10	UTSW	10	78210760	splice site	probably benign
R0605:Trappc10	UTSW	10	78201497	missense	possibly damaging	0.70
R1806:Trappc10	UTSW	10	78210776	missense	probably damaging	0.99
R1856:Trappc10	UTSW	10	78196451	missense	probably benign	0.00
R2045:Trappc10	UTSW	10	78209479	splice site	probably benign
R2088:Trappc10	UTSW	10	78196334	missense	probably benign	0.00
R2126:Trappc10	UTSW	10	78203924	missense	possibly damaging	0.94
R2202:Trappc10	UTSW	10	78199042	critical splice donor site	probably null
R2509:Trappc10	UTSW	10	78211523	missense	possibly damaging	0.51
R2510:Trappc10	UTSW	10	78211523	missense	possibly damaging	0.51
R2511:Trappc10	UTSW	10	78211523	missense	possibly damaging	0.51
R2893:Trappc10	UTSW	10	78193401	missense	probably benign	0.00
R3744:Trappc10	UTSW	10	78199090	missense	probably benign	0.00
R3778:Trappc10	UTSW	10	78200802	missense	possibly damaging	0.89
R3876:Trappc10	UTSW	10	78220186	splice site	probably null
R3930:Trappc10	UTSW	10	78210403	missense	probably benign	0.03
R4078:Trappc10	UTSW	10	78210382	missense	probably damaging	1.00
R4111:Trappc10	UTSW	10	78196430	missense	probably benign	0.09
R4418:Trappc10	UTSW	10	78217188	missense	probably damaging	1.00
R4549:Trappc10	UTSW	10	78231458	missense	probably damaging	1.00
R4695:Trappc10	UTSW	10	78197863	missense	probably damaging	0.99
R4799:Trappc10	UTSW	10	78201590	missense	possibly damaging	0.71
R5022:Trappc10	UTSW	10	78217160	missense	possibly damaging	0.72
R5023:Trappc10	UTSW	10	78217160	missense	possibly damaging	0.72
R5026:Trappc10	UTSW	10	78204288	missense	possibly damaging	0.82
R5057:Trappc10	UTSW	10	78217160	missense	possibly damaging	0.72
R5282:Trappc10	UTSW	10	78187860	missense	probably damaging	1.00
R5813:Trappc10	UTSW	10	78222739	missense	probably damaging	1.00
R5831:Trappc10	UTSW	10	78209426	missense	probably damaging	1.00
R6209:Trappc10	UTSW	10	78214812	missense	possibly damaging	0.50
R6450:Trappc10	UTSW	10	78209450	missense	possibly damaging	0.92
R6520:Trappc10	UTSW	10	78201453	missense	probably benign	0.00
R6533:Trappc10	UTSW	10	78188894	missense	probably damaging	0.96
R6767:Trappc10	UTSW	10	78193511	missense	possibly damaging	0.75
R6798:Trappc10	UTSW	10	78188831	missense	probably benign	0.00
R7205:Trappc10	UTSW	10	78210428	missense	probably damaging	1.00
R7282:Trappc10	UTSW	10	78207493	missense	probably damaging	0.98
R7378:Trappc10	UTSW	10	78193418	missense	probably damaging	0.96
R7384:Trappc10	UTSW	10	78209384	missense	possibly damaging	0.85
R7770:Trappc10	UTSW	10	78210845	missense	probably damaging	0.96
R7829:Trappc10	UTSW	10	78199075	missense	probably benign
R7839:Trappc10	UTSW	10	78188812	missense	possibly damaging	0.84
R8298:Trappc10	UTSW	10	78202919	missense	probably damaging	1.00
R8306:Trappc10	UTSW	10	78200626	missense	possibly damaging	0.54
R8814:Trappc10	UTSW	10	78202919	missense	probably damaging	1.00
R9035:Trappc10	UTSW	10	78207889	unclassified	probably benign
R9075:Trappc10	UTSW	10	78204296	missense	possibly damaging	0.77
R9112:Trappc10	UTSW	10	78193367	missense	probably damaging	0.99
R9182:Trappc10	UTSW	10	78214630	missense	probably damaging	1.00
R9444:Trappc10	UTSW	10	78197778	missense	probably benign	0.10
R9801:Trappc10	UTSW	10	78209429	missense	probably benign	0.00
Z1177:Trappc10	UTSW	10	78217153	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCGCAATGAGTGAACTGAAC -3'
(R):5'- ACTTAACTTGAAGCGTGTGTG -3'

Sequencing Primer
(F):5'- CTGAACTTCAGTACTTCTAACATGAG -3'
(R):5'- AACTTGAAGCGTGTGTGTCCTATAG -3'

Posted On

2016-08-04