Incidental Mutation 'R5363:R3hdm4'
ID422936
Institutional Source Beutler Lab
Gene Symbol R3hdm4
Ensembl Gene ENSMUSG00000035781
Gene NameR3H domain containing 4
Synonyms
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5363 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79910052-79921208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79912458 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 162 (E162K)
Ref Sequence ENSEMBL: ENSMUSP00000132266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045529] [ENSMUST00000045628] [ENSMUST00000105378] [ENSMUST00000164705] [ENSMUST00000165684] [ENSMUST00000166964] [ENSMUST00000170409] [ENSMUST00000171416] [ENSMUST00000181321] [ENSMUST00000217976] [ENSMUST00000218750] [ENSMUST00000218970] [ENSMUST00000219867]
Predicted Effect probably benign
Transcript: ENSMUST00000045529
SMART Domains Protein: ENSMUSP00000040516
Gene: ENSMUSG00000035773

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 53 338 1.7e-6 PFAM
Pfam:7tm_1 59 323 7e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000045628
AA Change: E162K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044570
Gene: ENSMUSG00000035781
AA Change: E162K

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Pfam:R3H-assoc 43 177 1.2e-35 PFAM
Pfam:R3H 181 244 7.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105378
SMART Domains Protein: ENSMUSP00000101017
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
WD40 94 133 1.05e-7 SMART
Blast:WD40 143 169 4e-8 BLAST
low complexity region 206 217 N/A INTRINSIC
WD40 226 267 1.53e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163125
Predicted Effect probably benign
Transcript: ENSMUST00000164705
SMART Domains Protein: ENSMUSP00000129229
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 10 49 1.05e-7 SMART
Pfam:Med16 59 172 6.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165684
SMART Domains Protein: ENSMUSP00000129375
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
WD40 95 134 1.05e-7 SMART
Blast:WD40 144 170 4e-8 BLAST
low complexity region 207 218 N/A INTRINSIC
WD40 227 268 1.53e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166964
SMART Domains Protein: ENSMUSP00000128463
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 59 98 1.05e-7 SMART
Pfam:Med16 108 162 2.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170409
SMART Domains Protein: ENSMUSP00000126729
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 10 49 1.05e-7 SMART
Pfam:Med16 59 105 1.1e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171416
AA Change: E162K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132266
Gene: ENSMUSG00000035781
AA Change: E162K

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Pfam:R3H-assoc 43 177 4.9e-39 PFAM
Pfam:R3H 183 243 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178620
Predicted Effect probably benign
Transcript: ENSMUST00000181321
Predicted Effect probably benign
Transcript: ENSMUST00000217976
Predicted Effect probably benign
Transcript: ENSMUST00000218750
Predicted Effect probably benign
Transcript: ENSMUST00000218970
Predicted Effect probably benign
Transcript: ENSMUST00000219867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219883
Meta Mutation Damage Score 0.1452 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in R3hdm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02230:R3hdm4 APN 10 79912091 missense probably damaging 1.00
PIT4472001:R3hdm4 UTSW 10 79913555 critical splice donor site probably null
R0801:R3hdm4 UTSW 10 79913357 unclassified probably benign
R1167:R3hdm4 UTSW 10 79912073 critical splice donor site probably null
R3622:R3hdm4 UTSW 10 79912681 missense possibly damaging 0.96
R5264:R3hdm4 UTSW 10 79913341 missense probably benign 0.19
R5268:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5269:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5357:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5358:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5360:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5362:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5434:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5435:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5442:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5534:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5921:R3hdm4 UTSW 10 79913619 missense probably damaging 1.00
R6041:R3hdm4 UTSW 10 79913661 missense possibly damaging 0.46
R7391:R3hdm4 UTSW 10 79911109 missense probably benign 0.00
R7496:R3hdm4 UTSW 10 79916874 missense probably damaging 0.99
R7913:R3hdm4 UTSW 10 79911945 missense probably damaging 1.00
R7983:R3hdm4 UTSW 10 79912723 missense probably damaging 1.00
X0022:R3hdm4 UTSW 10 79913652 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATTCATTTCCACTGCCCAG -3'
(R):5'- CGTTACTTGGAGGATGAGAGCC -3'

Sequencing Primer
(F):5'- AGTCCTCTCCTTCCTAACCACTG -3'
(R):5'- CCAGGGCAAGCGGAGAC -3'
Posted On2016-08-04