Incidental Mutation 'R5363:Or10p21'
ID 422937
Institutional Source Beutler Lab
Gene Symbol Or10p21
Ensembl Gene ENSMUSG00000063374
Gene Name olfactory receptor family 10 subfamily P member 21
Synonyms MOR269-2, GA_x6K02T2PULF-10696986-10697915, Olfr763
MMRRC Submission 042941-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R5363 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 128847156-128848085 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 128847783 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 210 (P210T)
Ref Sequence ENSEMBL: ENSMUSP00000076671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077460]
AlphaFold Q8VGC1
Predicted Effect probably damaging
Transcript: ENSMUST00000077460
AA Change: P210T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076671
Gene: ENSMUSG00000063374
AA Change: P210T

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.9e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.3e-10 PFAM
Pfam:7tm_1 41 290 6.9e-15 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,132,963 (GRCm39) I40T probably benign Het
Abca13 T C 11: 9,227,035 (GRCm39) V597A possibly damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Anapc1 A G 2: 128,492,114 (GRCm39) probably null Het
Ap4e1 G A 2: 126,879,784 (GRCm39) probably null Het
Apod T C 16: 31,129,909 (GRCm39) T16A probably benign Het
Arrdc5 C T 17: 56,607,138 (GRCm39) V36M probably damaging Het
Bcan A G 3: 87,902,794 (GRCm39) V328A probably damaging Het
Bche A G 3: 73,607,972 (GRCm39) Y485H probably damaging Het
Btbd6 A G 12: 112,941,756 (GRCm39) Y356C probably damaging Het
Cdh4 A G 2: 179,528,556 (GRCm39) T555A probably benign Het
Ciita C T 16: 10,330,031 (GRCm39) H769Y probably damaging Het
Clspn A G 4: 126,455,579 (GRCm39) D35G possibly damaging Het
Cpsf3 T A 12: 21,358,986 (GRCm39) M562K probably benign Het
Cstdc1 G T 2: 148,625,298 (GRCm39) L77F probably damaging Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,759,803 (GRCm39) probably null Het
Cyp2a22 T A 7: 26,635,858 (GRCm39) Q235L probably damaging Het
Dicer1 A G 12: 104,669,410 (GRCm39) S1091P probably damaging Het
Dync1li1 T A 9: 114,544,297 (GRCm39) I323N probably damaging Het
Fat4 A G 3: 38,942,154 (GRCm39) N349S probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Hectd4 T C 5: 121,448,666 (GRCm39) M338T probably benign Het
Insyn2b G A 11: 34,352,788 (GRCm39) E277K probably damaging Het
Lactb2 A T 1: 13,700,356 (GRCm39) I225N probably benign Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Mrps30 A G 13: 118,523,698 (GRCm39) S25P probably benign Het
Myg1 T C 15: 102,246,259 (GRCm39) V378A probably benign Het
Notch4 C T 17: 34,806,097 (GRCm39) T1731I probably damaging Het
Ntmt1 A G 2: 30,710,660 (GRCm39) D121G probably damaging Het
Or5d39 A T 2: 87,980,146 (GRCm39) D72E probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pclo A G 5: 14,719,424 (GRCm39) D1187G unknown Het
Pkd1 T A 17: 24,784,047 (GRCm39) Y198N probably benign Het
Plk4 T A 3: 40,756,419 (GRCm39) N83K possibly damaging Het
Prune2 A T 19: 17,095,630 (GRCm39) Q378L probably damaging Het
R3hdm4 C T 10: 79,748,292 (GRCm39) E162K possibly damaging Het
Rasa1 G T 13: 85,436,674 (GRCm39) T118K possibly damaging Het
Rin3 G A 12: 102,292,093 (GRCm39) V97M probably damaging Het
Rock2 T C 12: 17,015,655 (GRCm39) probably null Het
Slc34a1 A G 13: 55,551,081 (GRCm39) I289V probably benign Het
Slc34a1 T C 13: 55,560,103 (GRCm39) L443P probably damaging Het
Slco2a1 A T 9: 102,947,462 (GRCm39) I254F probably damaging Het
Spink11 T C 18: 44,328,753 (GRCm39) I32V probably benign Het
Spire1 T C 18: 67,639,625 (GRCm39) E296G probably damaging Het
Sun1 A G 5: 139,220,498 (GRCm39) N410D probably damaging Het
Syt14 T A 1: 192,612,971 (GRCm39) T610S possibly damaging Het
Tenm3 T C 8: 48,740,866 (GRCm39) I1206V possibly damaging Het
Tet3 A T 6: 83,353,746 (GRCm39) probably null Het
Thbs1 A T 2: 117,953,147 (GRCm39) Q919L probably damaging Het
Trappc10 A G 10: 78,024,674 (GRCm39) F1152L possibly damaging Het
Trp63 C A 16: 25,682,468 (GRCm39) N176K probably damaging Het
Zbtb17 A G 4: 141,194,072 (GRCm39) E700G probably benign Het
Zfp446 G A 7: 12,711,984 (GRCm39) R69H probably benign Het
Zfy2 C T Y: 2,106,555 (GRCm39) C693Y possibly damaging Het
Zxdc A G 6: 90,359,128 (GRCm39) T587A probably damaging Het
Zyg11a A G 4: 108,046,819 (GRCm39) C552R probably damaging Het
Other mutations in Or10p21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Or10p21 APN 10 128,847,729 (GRCm39) missense probably damaging 1.00
IGL01571:Or10p21 APN 10 128,847,696 (GRCm39) missense probably damaging 0.99
R0189:Or10p21 UTSW 10 128,847,191 (GRCm39) missense possibly damaging 0.88
R2079:Or10p21 UTSW 10 128,847,898 (GRCm39) missense probably damaging 1.00
R5074:Or10p21 UTSW 10 128,847,213 (GRCm39) missense possibly damaging 0.55
R5905:Or10p21 UTSW 10 128,847,156 (GRCm39) start codon destroyed probably benign 0.01
R7943:Or10p21 UTSW 10 128,847,934 (GRCm39) missense possibly damaging 0.88
R8195:Or10p21 UTSW 10 128,847,444 (GRCm39) missense probably damaging 1.00
R8240:Or10p21 UTSW 10 128,847,766 (GRCm39) missense possibly damaging 0.53
R8936:Or10p21 UTSW 10 128,847,802 (GRCm39) missense probably benign 0.01
R9621:Or10p21 UTSW 10 128,847,759 (GRCm39) missense probably benign 0.04
Z1177:Or10p21 UTSW 10 128,847,040 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGGTGTCATCTCAGGCACTAC -3'
(R):5'- GTGACCTCCTTGTTCCTCAGAG -3'

Sequencing Primer
(F):5'- GTGTCATCTCAGGCACTACTCACTC -3'
(R):5'- AATTTGGTCAGTGTCCCCAAAGG -3'
Posted On 2016-08-04