Incidental Mutation 'R5363:Olfr763'
ID422937
Institutional Source Beutler Lab
Gene Symbol Olfr763
Ensembl Gene ENSMUSG00000063374
Gene Nameolfactory receptor 763
SynonymsGA_x6K02T2PULF-10696986-10697915, MOR269-2
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R5363 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129010791-129013313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 129011914 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 210 (P210T)
Ref Sequence ENSEMBL: ENSMUSP00000076671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077460]
Predicted Effect probably damaging
Transcript: ENSMUST00000077460
AA Change: P210T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076671
Gene: ENSMUSG00000063374
AA Change: P210T

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.9e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.3e-10 PFAM
Pfam:7tm_1 41 290 6.9e-15 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Olfr763
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Olfr763 APN 10 129011860 missense probably damaging 1.00
IGL01571:Olfr763 APN 10 129011827 missense probably damaging 0.99
R0189:Olfr763 UTSW 10 129011322 missense possibly damaging 0.88
R2079:Olfr763 UTSW 10 129012029 missense probably damaging 1.00
R5074:Olfr763 UTSW 10 129011344 missense possibly damaging 0.55
R5905:Olfr763 UTSW 10 129011287 start codon destroyed probably benign 0.01
R7943:Olfr763 UTSW 10 129012065 missense possibly damaging 0.88
R8195:Olfr763 UTSW 10 129011575 missense probably damaging 1.00
R8240:Olfr763 UTSW 10 129011897 missense possibly damaging 0.53
Z1177:Olfr763 UTSW 10 129011171 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGGTGTCATCTCAGGCACTAC -3'
(R):5'- GTGACCTCCTTGTTCCTCAGAG -3'

Sequencing Primer
(F):5'- GTGTCATCTCAGGCACTACTCACTC -3'
(R):5'- AATTTGGTCAGTGTCCCCAAAGG -3'
Posted On2016-08-04