Mutagenetix > Incidental Mutation

Incidental Mutation 'R5363:Otx1'

422939

Institutional Source

Beutler Lab

Gene Symbol

Otx1

Ensembl Gene

ENSMUSG00000005917

Gene Name

orthodenticle homeobox 1

Synonyms

A730044F23Rik, jv

MMRRC Submission

042941-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.855) question?

Stock #

R5363 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21994764-22002897 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 21997037 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 91 (A91S)

Ref Sequence

ENSEMBL: ENSMUSP00000134704 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006071] [ENSMUST00000147486]

AlphaFold

P80205

Predicted Effect

probably damaging
Transcript: ENSMUST00000006071
AA Change: A91S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000006071
Gene: ENSMUSG00000005917
AA Change: A91S

Domain	Start	End	E-Value	Type
HOX	38	100	1.21e-25	SMART
low complexity region	117	125	N/A	INTRINSIC
Pfam:TF_Otx	178	279	2.5e-39	PFAM
internal_repeat_1	310	322	1.39e-7	PROSPERO
low complexity region	324	331	N/A	INTRINSIC
internal_repeat_1	334	346	1.39e-7	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000147486
AA Change: A91S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134704
Gene: ENSMUSG00000005917
AA Change: A91S

Domain	Start	End	E-Value	Type
HOX	38	100	1.21e-25	SMART
low complexity region	117	125	N/A	INTRINSIC
low complexity region	133	147	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172395

Meta Mutation Damage Score

0.4867

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the bicoid subfamily of the paired homeobox transcription factor family. The encoded protein is critical to the maintenance and regionalization of the forebrain and midbrain during development. It may also have important functions in sense organ development, pituitary function, and in the regulation of blood cell production. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inner ear abnormalities and circling/head-shaking behavior are seen in mild mutants; null mutants also have spontaneous seizures and defects in dorsal telencephalic cortex, mesencephalon, cerebellum and eye; and show delayed growth and sexual maturation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Abca1	A	G	4: 53,132,963	I40T	probably benign	Het
Abca13	T	C	11: 9,277,035	V597A	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc1	A	G	2: 128,650,194		probably null	Het
Ap4e1	G	A	2: 127,037,864		probably null	Het
Apod	T	C	16: 31,311,091	T16A	probably benign	Het
Arrdc5	C	T	17: 56,300,138	V36M	probably damaging	Het
Bcan	A	G	3: 87,995,487	V328A	probably damaging	Het
Bche	A	G	3: 73,700,639	Y485H	probably damaging	Het
Btbd6	A	G	12: 112,978,136	Y356C	probably damaging	Het
Cdh4	A	G	2: 179,886,763	T555A	probably benign	Het
Ciita	C	T	16: 10,512,167	H769Y	probably damaging	Het
Clspn	A	G	4: 126,561,786	D35G	possibly damaging	Het
Cpsf3	T	A	12: 21,308,985	M562K	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cyp2a22	T	A	7: 26,936,433	Q235L	probably damaging	Het
Dicer1	A	G	12: 104,703,151	S1091P	probably damaging	Het
Dync1li1	T	A	9: 114,715,229	I323N	probably damaging	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat4	A	G	3: 38,888,005	N349S	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Hectd4	T	C	5: 121,310,603	M338T	probably benign	Het
Lactb2	A	T	1: 13,630,132	I225N	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mrps30	A	G	13: 118,387,162	S25P	probably benign	Het
Myg1	T	C	15: 102,337,824	V378A	probably benign	Het
Notch4	C	T	17: 34,587,123	T1731I	probably damaging	Het
Ntmt1	A	G	2: 30,820,648	D121G	probably damaging	Het
Olfr1167	A	T	2: 88,149,802	D72E	probably damaging	Het
Olfr763	C	A	10: 129,011,914	P210T	probably damaging	Het
Pclo	A	G	5: 14,669,410	D1187G	unknown	Het
Pkd1	T	A	17: 24,565,073	Y198N	probably benign	Het
Plk4	T	A	3: 40,801,984	N83K	possibly damaging	Het
Prune2	A	T	19: 17,118,266	Q378L	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rasa1	G	T	13: 85,288,555	T118K	possibly damaging	Het
Rin3	G	A	12: 102,325,834	V97M	probably damaging	Het
Rock2	T	C	12: 16,965,654		probably null	Het
Slc34a1	A	G	13: 55,403,268	I289V	probably benign	Het
Slc34a1	T	C	13: 55,412,290	L443P	probably damaging	Het
Slco2a1	A	T	9: 103,070,263	I254F	probably damaging	Het
Spink11	T	C	18: 44,195,686	I32V	probably benign	Het
Spire1	T	C	18: 67,506,555	E296G	probably damaging	Het
Sun1	A	G	5: 139,234,743	N410D	probably damaging	Het
Syt14	T	A	1: 192,930,663	T610S	possibly damaging	Het
Tenm3	T	C	8: 48,287,831	I1206V	possibly damaging	Het
Tet3	A	T	6: 83,376,764		probably null	Het
Thbs1	A	T	2: 118,122,666	Q919L	probably damaging	Het
Trappc10	A	G	10: 78,188,840	F1152L	possibly damaging	Het
Trp63	C	A	16: 25,863,718	N176K	probably damaging	Het
Zbtb17	A	G	4: 141,466,761	E700G	probably benign	Het
Zfp446	G	A	7: 12,978,057	R69H	probably benign	Het
Zfy2	C	T	Y: 2,106,555	C693Y	possibly damaging	Het
Zxdc	A	G	6: 90,382,146	T587A	probably damaging	Het
Zyg11a	A	G	4: 108,189,622	C552R	probably damaging	Het

Other mutations in Otx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00574:Otx1	APN	11	21996794	unclassified	probably benign
Embarrassed	UTSW	11	21997037	missense	probably damaging	1.00
R1946:Otx1	UTSW	11	21998482	missense	probably damaging	1.00
R2291:Otx1	UTSW	11	21996634	unclassified	probably benign
R2870:Otx1	UTSW	11	21998681	intron	probably benign
R4164:Otx1	UTSW	11	21996638	unclassified	probably benign
R4845:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R4925:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R4934:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R4993:Otx1	UTSW	11	21998532	splice site	probably null
R5061:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5062:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5063:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5068:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5069:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5070:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5097:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5169:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5170:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5171:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5172:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5198:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5199:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5200:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5201:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5202:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5203:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5204:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5205:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5256:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5267:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5360:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5361:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5372:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5375:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5380:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5381:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5382:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5383:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5415:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5416:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5534:Otx1	UTSW	11	21996296	unclassified	probably benign
R5592:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5594:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5725:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5727:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5735:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5736:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5841:Otx1	UTSW	11	21998594	intron	probably benign
R5940:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R5941:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6080:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6081:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6093:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6126:Otx1	UTSW	11	21996457	unclassified	probably benign
R6131:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6132:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6134:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6187:Otx1	UTSW	11	21999406	missense	probably damaging	1.00
R6220:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6269:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6270:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6271:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6272:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6396:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6619:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6624:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6680:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6681:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6718:Otx1	UTSW	11	21996412	unclassified	probably benign
R6831:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6834:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
R6985:Otx1	UTSW	11	21996615	nonsense	probably null
R7631:Otx1	UTSW	11	21999458	nonsense	probably null
R8100:Otx1	UTSW	11	21999392	missense	probably benign	0.16
R9125:Otx1	UTSW	11	21999458	nonsense	probably null
R9541:Otx1	UTSW	11	21997052	missense	probably damaging	1.00
X0054:Otx1	UTSW	11	21996331	unclassified	probably benign
Z1187:Otx1	UTSW	11	21997037	missense	probably damaging	1.00
Z1192:Otx1	UTSW	11	21997037	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCCAGATGGACGAAGCAGTAG -3'
(R):5'- CTTACTAGGGGTTTGCGCAG -3'

Sequencing Primer
(F):5'- TCAGAGAGGACGCTGCTG -3'
(R):5'- TTTGCGCAGAAGGATGGG -3'

Posted On

2016-08-04