Incidental Mutation 'R5363:Otx1'
ID422939
Institutional Source Beutler Lab
Gene Symbol Otx1
Ensembl Gene ENSMUSG00000005917
Gene Nameorthodenticle homeobox 1
SynonymsA730044F23Rik, jv
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.847) question?
Stock #R5363 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location21994764-22002897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 21997037 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 91 (A91S)
Ref Sequence ENSEMBL: ENSMUSP00000134704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006071] [ENSMUST00000147486]
Predicted Effect probably damaging
Transcript: ENSMUST00000006071
AA Change: A91S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006071
Gene: ENSMUSG00000005917
AA Change: A91S

DomainStartEndE-ValueType
HOX 38 100 1.21e-25 SMART
low complexity region 117 125 N/A INTRINSIC
Pfam:TF_Otx 178 279 2.5e-39 PFAM
internal_repeat_1 310 322 1.39e-7 PROSPERO
low complexity region 324 331 N/A INTRINSIC
internal_repeat_1 334 346 1.39e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000147486
AA Change: A91S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134704
Gene: ENSMUSG00000005917
AA Change: A91S

DomainStartEndE-ValueType
HOX 38 100 1.21e-25 SMART
low complexity region 117 125 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172395
Meta Mutation Damage Score 0.4867 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the bicoid subfamily of the paired homeobox transcription factor family. The encoded protein is critical to the maintenance and regionalization of the forebrain and midbrain during development. It may also have important functions in sense organ development, pituitary function, and in the regulation of blood cell production. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inner ear abnormalities and circling/head-shaking behavior are seen in mild mutants; null mutants also have spontaneous seizures and defects in dorsal telencephalic cortex, mesencephalon, cerebellum and eye; and show delayed growth and sexual maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Otx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Otx1 APN 11 21996794 unclassified probably benign
Embarrassed UTSW 11 21997037 missense probably damaging 1.00
R1946:Otx1 UTSW 11 21998482 missense probably damaging 1.00
R2291:Otx1 UTSW 11 21996634 unclassified probably benign
R2870:Otx1 UTSW 11 21998681 intron probably benign
R4164:Otx1 UTSW 11 21996638 unclassified probably benign
R4845:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R4925:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R4934:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R4993:Otx1 UTSW 11 21998532 splice site probably null
R5061:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5062:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5063:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5068:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5069:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5070:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5097:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5169:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5170:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5171:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5172:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5198:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5199:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5200:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5201:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5202:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5203:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5204:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5205:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5256:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5267:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5360:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5361:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5372:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5375:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5380:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5381:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5382:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5383:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5415:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5416:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5534:Otx1 UTSW 11 21996296 unclassified probably benign
R5592:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5594:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5725:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5727:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5735:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5736:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5841:Otx1 UTSW 11 21998594 intron probably benign
R5940:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5941:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6080:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6081:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6093:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6126:Otx1 UTSW 11 21996457 unclassified probably benign
R6131:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6132:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6134:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6187:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6220:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6269:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6270:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6271:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6272:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6396:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6619:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6624:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6680:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6681:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6718:Otx1 UTSW 11 21996412 unclassified probably benign
R6831:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6834:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6985:Otx1 UTSW 11 21996615 nonsense probably null
R7631:Otx1 UTSW 11 21999458 nonsense probably null
R8100:Otx1 UTSW 11 21999392 missense probably benign 0.16
X0054:Otx1 UTSW 11 21996331 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTCCAGATGGACGAAGCAGTAG -3'
(R):5'- CTTACTAGGGGTTTGCGCAG -3'

Sequencing Primer
(F):5'- TCAGAGAGGACGCTGCTG -3'
(R):5'- TTTGCGCAGAAGGATGGG -3'
Posted On2016-08-04