Mutagenetix > Incidental Mutation

Incidental Mutation 'R5363:Rock2'

422943

Institutional Source

Beutler Lab

Gene Symbol

Rock2

Ensembl Gene

ENSMUSG00000020580

Gene Name

Rho-associated coiled-coil containing protein kinase 2

Synonyms

B230113H15Rik, ROKalpha, Rho-kinase, Rock-II, Rock2m

MMRRC Submission

042941-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.858) question?

Stock #

R5363 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16894895-16987823 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 16965654 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000152813 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020904] [ENSMUST00000020904] [ENSMUST00000220688]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000020904

SMART Domains

Protein: ENSMUSP00000020904
Gene: ENSMUSG00000020580

Domain	Start	End	E-Value	Type
low complexity region	46	58	N/A	INTRINSIC
S_TKc	92	354	9.2e-96	SMART
S_TK_X	357	417	3.24e-13	SMART
PDB:3O0Z\|D	552	717	4e-46	PDB
low complexity region	723	743	N/A	INTRINSIC
low complexity region	882	909	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
Pfam:Rho_Binding	978	1046	4.7e-28	PFAM
coiled coil region	1054	1126	N/A	INTRINSIC
PH	1151	1351	2.88e-5	SMART
C1	1261	1315	2.21e-12	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000020904

SMART Domains

Protein: ENSMUSP00000020904
Gene: ENSMUSG00000020580

Domain	Start	End	E-Value	Type
low complexity region	46	58	N/A	INTRINSIC
S_TKc	92	354	9.2e-96	SMART
S_TK_X	357	417	3.24e-13	SMART
PDB:3O0Z\|D	552	717	4e-46	PDB
low complexity region	723	743	N/A	INTRINSIC
low complexity region	882	909	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
Pfam:Rho_Binding	978	1046	4.7e-28	PFAM
coiled coil region	1054	1126	N/A	INTRINSIC
PH	1151	1351	2.88e-5	SMART
C1	1261	1315	2.21e-12	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000220688

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase that regulates cytokinesis, smooth muscle contraction, the formation of actin stress fibers and focal adhesions, and the activation of the c-fos serum response element. This protein, which is an isozyme of ROCK1 is a target for the small GTPase Rho. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this genes tend to die before birth; those that survive are small. Hemorrhaging occurs in the placenta, at the tips of hind limb buds and occasionally the tail. Subsequent development is normal and the size deficit is made up. They are fertile as adults. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Abca1	A	G	4: 53,132,963	I40T	probably benign	Het
Abca13	T	C	11: 9,277,035	V597A	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc1	A	G	2: 128,650,194		probably null	Het
Ap4e1	G	A	2: 127,037,864		probably null	Het
Apod	T	C	16: 31,311,091	T16A	probably benign	Het
Arrdc5	C	T	17: 56,300,138	V36M	probably damaging	Het
Bcan	A	G	3: 87,995,487	V328A	probably damaging	Het
Bche	A	G	3: 73,700,639	Y485H	probably damaging	Het
Btbd6	A	G	12: 112,978,136	Y356C	probably damaging	Het
Cdh4	A	G	2: 179,886,763	T555A	probably benign	Het
Ciita	C	T	16: 10,512,167	H769Y	probably damaging	Het
Clspn	A	G	4: 126,561,786	D35G	possibly damaging	Het
Cpsf3	T	A	12: 21,308,985	M562K	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cyp2a22	T	A	7: 26,936,433	Q235L	probably damaging	Het
Dicer1	A	G	12: 104,703,151	S1091P	probably damaging	Het
Dync1li1	T	A	9: 114,715,229	I323N	probably damaging	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat4	A	G	3: 38,888,005	N349S	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Hectd4	T	C	5: 121,310,603	M338T	probably benign	Het
Lactb2	A	T	1: 13,630,132	I225N	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mrps30	A	G	13: 118,387,162	S25P	probably benign	Het
Myg1	T	C	15: 102,337,824	V378A	probably benign	Het
Notch4	C	T	17: 34,587,123	T1731I	probably damaging	Het
Ntmt1	A	G	2: 30,820,648	D121G	probably damaging	Het
Olfr1167	A	T	2: 88,149,802	D72E	probably damaging	Het
Olfr763	C	A	10: 129,011,914	P210T	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pclo	A	G	5: 14,669,410	D1187G	unknown	Het
Pkd1	T	A	17: 24,565,073	Y198N	probably benign	Het
Plk4	T	A	3: 40,801,984	N83K	possibly damaging	Het
Prune2	A	T	19: 17,118,266	Q378L	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rasa1	G	T	13: 85,288,555	T118K	possibly damaging	Het
Rin3	G	A	12: 102,325,834	V97M	probably damaging	Het
Slc34a1	A	G	13: 55,403,268	I289V	probably benign	Het
Slc34a1	T	C	13: 55,412,290	L443P	probably damaging	Het
Slco2a1	A	T	9: 103,070,263	I254F	probably damaging	Het
Spink11	T	C	18: 44,195,686	I32V	probably benign	Het
Spire1	T	C	18: 67,506,555	E296G	probably damaging	Het
Sun1	A	G	5: 139,234,743	N410D	probably damaging	Het
Syt14	T	A	1: 192,930,663	T610S	possibly damaging	Het
Tenm3	T	C	8: 48,287,831	I1206V	possibly damaging	Het
Tet3	A	T	6: 83,376,764		probably null	Het
Thbs1	A	T	2: 118,122,666	Q919L	probably damaging	Het
Trappc10	A	G	10: 78,188,840	F1152L	possibly damaging	Het
Trp63	C	A	16: 25,863,718	N176K	probably damaging	Het
Zbtb17	A	G	4: 141,466,761	E700G	probably benign	Het
Zfp446	G	A	7: 12,978,057	R69H	probably benign	Het
Zfy2	C	T	Y: 2,106,555	C693Y	possibly damaging	Het
Zxdc	A	G	6: 90,382,146	T587A	probably damaging	Het
Zyg11a	A	G	4: 108,189,622	C552R	probably damaging	Het

Other mutations in Rock2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00959:Rock2	APN	12	16978055	missense	probably benign	0.11
IGL01565:Rock2	APN	12	16953317	missense	possibly damaging	0.62
IGL01637:Rock2	APN	12	16965171	missense	probably benign
IGL02164:Rock2	APN	12	16965529	missense	probably damaging	1.00
IGL02249:Rock2	APN	12	16971041	unclassified	probably benign
IGL02490:Rock2	APN	12	16948563	missense	probably damaging	1.00
IGL02815:Rock2	APN	12	16966701	splice site	probably benign
IGL02979:Rock2	APN	12	16977940	missense	probably benign	0.00
IGL03095:Rock2	APN	12	16953340	missense	probably benign	0.00
IGL03198:Rock2	APN	12	16975507	missense	probably benign	0.27
R0087:Rock2	UTSW	12	16928966	missense	probably benign	0.20
R0189:Rock2	UTSW	12	16959516	splice site	probably benign
R0282:Rock2	UTSW	12	16977886	splice site	probably benign
R0497:Rock2	UTSW	12	16954953	missense	probably benign
R1210:Rock2	UTSW	12	16965469	missense	probably damaging	0.96
R1347:Rock2	UTSW	12	16977624	missense	possibly damaging	0.70
R1347:Rock2	UTSW	12	16977624	missense	possibly damaging	0.70
R1616:Rock2	UTSW	12	16972985	missense	probably benign	0.03
R1672:Rock2	UTSW	12	16965652	missense	probably benign	0.03
R1815:Rock2	UTSW	12	16972726	missense	probably benign	0.01
R1840:Rock2	UTSW	12	16928989	missense	probably benign
R2349:Rock2	UTSW	12	16977615	missense	probably benign	0.07
R3149:Rock2	UTSW	12	16965091	missense	probably damaging	1.00
R3979:Rock2	UTSW	12	16972736	missense	probably damaging	1.00
R4030:Rock2	UTSW	12	16975479	missense	probably damaging	1.00
R4470:Rock2	UTSW	12	16971275	nonsense	probably null
R4492:Rock2	UTSW	12	16977683	missense	probably damaging	1.00
R4519:Rock2	UTSW	12	16977737	missense	probably damaging	1.00
R4776:Rock2	UTSW	12	16977740	missense	probably damaging	1.00
R4794:Rock2	UTSW	12	16940407	missense	probably damaging	1.00
R4908:Rock2	UTSW	12	16959491	missense	probably benign	0.00
R5574:Rock2	UTSW	12	16961641	missense	possibly damaging	0.55
R5595:Rock2	UTSW	12	16942809	missense	probably damaging	1.00
R6158:Rock2	UTSW	12	16954918	missense	probably benign
R6728:Rock2	UTSW	12	16961736	missense	probably benign	0.00
R6828:Rock2	UTSW	12	16942959	splice site	probably null
R7019:Rock2	UTSW	12	16977740	missense	probably damaging	1.00
R7181:Rock2	UTSW	12	16973143	missense	probably benign	0.00
R7236:Rock2	UTSW	12	16929002	missense	probably damaging	1.00
R7362:Rock2	UTSW	12	16958421	missense	probably damaging	1.00
R7593:Rock2	UTSW	12	16958240	missense	probably benign	0.00
R7743:Rock2	UTSW	12	16976047	missense	probably damaging	1.00
R7782:Rock2	UTSW	12	16971110	missense	probably benign	0.17
R7935:Rock2	UTSW	12	16948557	missense	probably damaging	1.00
R8012:Rock2	UTSW	12	16942742	missense	probably damaging	1.00
R8339:Rock2	UTSW	12	16974860	missense	probably damaging	0.98
R8809:Rock2	UTSW	12	16965654	critical splice donor site	probably benign
R8918:Rock2	UTSW	12	16940421	nonsense	probably null
R9198:Rock2	UTSW	12	16965556	missense	probably benign
R9449:Rock2	UTSW	12	16977762	missense	probably damaging	1.00
R9717:Rock2	UTSW	12	16965601	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- AACTTGCTTTATTGCGGAGGTC -3'
(R):5'- GCTGGCTCTGGAATTCAAATCTC -3'

Sequencing Primer
(F):5'- CGGAGGTCTAGTGGTGAATGC -3'
(R):5'- GGAATTCAAATCTCTTGTTTCACCC -3'

Posted On

2016-08-04