Incidental Mutation 'R5363:Rock2'
ID422943
Institutional Source Beutler Lab
Gene Symbol Rock2
Ensembl Gene ENSMUSG00000020580
Gene NameRho-associated coiled-coil containing protein kinase 2
SynonymsB230113H15Rik, ROKalpha, Rho-kinase, Rock-II, Rock2m
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.768) question?
Stock #R5363 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location16894895-16987823 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 16965654 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020904] [ENSMUST00000020904] [ENSMUST00000220688]
Predicted Effect probably null
Transcript: ENSMUST00000020904
SMART Domains Protein: ENSMUSP00000020904
Gene: ENSMUSG00000020580

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
S_TKc 92 354 9.2e-96 SMART
S_TK_X 357 417 3.24e-13 SMART
PDB:3O0Z|D 552 717 4e-46 PDB
low complexity region 723 743 N/A INTRINSIC
low complexity region 882 909 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
Pfam:Rho_Binding 978 1046 4.7e-28 PFAM
coiled coil region 1054 1126 N/A INTRINSIC
PH 1151 1351 2.88e-5 SMART
C1 1261 1315 2.21e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000020904
SMART Domains Protein: ENSMUSP00000020904
Gene: ENSMUSG00000020580

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
S_TKc 92 354 9.2e-96 SMART
S_TK_X 357 417 3.24e-13 SMART
PDB:3O0Z|D 552 717 4e-46 PDB
low complexity region 723 743 N/A INTRINSIC
low complexity region 882 909 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
Pfam:Rho_Binding 978 1046 4.7e-28 PFAM
coiled coil region 1054 1126 N/A INTRINSIC
PH 1151 1351 2.88e-5 SMART
C1 1261 1315 2.21e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000220688
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase that regulates cytokinesis, smooth muscle contraction, the formation of actin stress fibers and focal adhesions, and the activation of the c-fos serum response element. This protein, which is an isozyme of ROCK1 is a target for the small GTPase Rho. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this genes tend to die before birth; those that survive are small. Hemorrhaging occurs in the placenta, at the tips of hind limb buds and occasionally the tail. Subsequent development is normal and the size deficit is made up. They are fertile as adults. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Rock2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Rock2 APN 12 16978055 missense probably benign 0.11
IGL01565:Rock2 APN 12 16953317 missense possibly damaging 0.62
IGL01637:Rock2 APN 12 16965171 missense probably benign
IGL02164:Rock2 APN 12 16965529 missense probably damaging 1.00
IGL02249:Rock2 APN 12 16971041 unclassified probably benign
IGL02490:Rock2 APN 12 16948563 missense probably damaging 1.00
IGL02815:Rock2 APN 12 16966701 splice site probably benign
IGL02979:Rock2 APN 12 16977940 missense probably benign 0.00
IGL03095:Rock2 APN 12 16953340 missense probably benign 0.00
IGL03198:Rock2 APN 12 16975507 missense probably benign 0.27
R0087:Rock2 UTSW 12 16928966 missense probably benign 0.20
R0189:Rock2 UTSW 12 16959516 splice site probably benign
R0282:Rock2 UTSW 12 16977886 splice site probably benign
R0497:Rock2 UTSW 12 16954953 missense probably benign
R1210:Rock2 UTSW 12 16965469 missense probably damaging 0.96
R1347:Rock2 UTSW 12 16977624 missense possibly damaging 0.70
R1347:Rock2 UTSW 12 16977624 missense possibly damaging 0.70
R1616:Rock2 UTSW 12 16972985 missense probably benign 0.03
R1672:Rock2 UTSW 12 16965652 missense probably benign 0.03
R1815:Rock2 UTSW 12 16972726 missense probably benign 0.01
R1840:Rock2 UTSW 12 16928989 missense probably benign
R2349:Rock2 UTSW 12 16977615 missense probably benign 0.07
R3149:Rock2 UTSW 12 16965091 missense probably damaging 1.00
R3979:Rock2 UTSW 12 16972736 missense probably damaging 1.00
R4030:Rock2 UTSW 12 16975479 missense probably damaging 1.00
R4470:Rock2 UTSW 12 16971275 nonsense probably null
R4492:Rock2 UTSW 12 16977683 missense probably damaging 1.00
R4519:Rock2 UTSW 12 16977737 missense probably damaging 1.00
R4776:Rock2 UTSW 12 16977740 missense probably damaging 1.00
R4794:Rock2 UTSW 12 16940407 missense probably damaging 1.00
R4908:Rock2 UTSW 12 16959491 missense probably benign 0.00
R5574:Rock2 UTSW 12 16961641 missense possibly damaging 0.55
R5595:Rock2 UTSW 12 16942809 missense probably damaging 1.00
R6158:Rock2 UTSW 12 16954918 missense probably benign
R6728:Rock2 UTSW 12 16961736 missense probably benign 0.00
R6828:Rock2 UTSW 12 16942959 splice site probably null
R7019:Rock2 UTSW 12 16977740 missense probably damaging 1.00
R7181:Rock2 UTSW 12 16973143 missense probably benign 0.00
R7236:Rock2 UTSW 12 16929002 missense probably damaging 1.00
R7362:Rock2 UTSW 12 16958421 missense probably damaging 1.00
R7593:Rock2 UTSW 12 16958240 missense probably benign 0.00
R7743:Rock2 UTSW 12 16976047 missense probably damaging 1.00
R7782:Rock2 UTSW 12 16971110 missense probably benign 0.17
R7935:Rock2 UTSW 12 16948557 missense probably damaging 1.00
R8012:Rock2 UTSW 12 16942742 missense probably damaging 1.00
R8339:Rock2 UTSW 12 16974860 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACTTGCTTTATTGCGGAGGTC -3'
(R):5'- GCTGGCTCTGGAATTCAAATCTC -3'

Sequencing Primer
(F):5'- CGGAGGTCTAGTGGTGAATGC -3'
(R):5'- GGAATTCAAATCTCTTGTTTCACCC -3'
Posted On2016-08-04