Mutagenetix > Incidental Mutation

Incidental Mutation 'R5363:Rin3'

422945

Institutional Source

Beutler Lab

Gene Symbol

Rin3

Ensembl Gene

ENSMUSG00000044456

Gene Name

Ras and Rab interactor 3

Synonyms

MMRRC Submission

042941-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5363 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102283048-102390855 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 102325834 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 97 (V97M)

Ref Sequence

ENSEMBL: ENSMUSP00000123268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056950] [ENSMUST00000101114] [ENSMUST00000133820] [ENSMUST00000150795]

AlphaFold

P59729

Predicted Effect

unknown
Transcript: ENSMUST00000056950
AA Change: V97M

SMART Domains

Protein: ENSMUSP00000060771
Gene: ENSMUSG00000044456
AA Change: V97M

Domain	Start	End	E-Value	Type
low complexity region	20	32	N/A	INTRINSIC
SH2	61	149	1.89e-2	SMART
low complexity region	254	311	N/A	INTRINSIC
low complexity region	316	325	N/A	INTRINSIC
low complexity region	358	380	N/A	INTRINSIC
low complexity region	448	469	N/A	INTRINSIC
low complexity region	514	523	N/A	INTRINSIC
low complexity region	579	594	N/A	INTRINSIC
low complexity region	714	728	N/A	INTRINSIC
VPS9	736	852	5.75e-38	SMART
RA	873	960	3.5e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101114
AA Change: V97M

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000098673
Gene: ENSMUSG00000044456
AA Change: V97M

Domain	Start	End	E-Value	Type
low complexity region	20	32	N/A	INTRINSIC
SH2	61	149	1.89e-2	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000133820
AA Change: V17M

SMART Domains

Protein: ENSMUSP00000122646
Gene: ENSMUSG00000044456
AA Change: V17M

Domain	Start	End	E-Value	Type
Blast:SH2	1	69	3e-39	BLAST
SCOP:d1a81a2	3	77	2e-4	SMART
low complexity region	174	231	N/A	INTRINSIC
low complexity region	236	245	N/A	INTRINSIC
low complexity region	278	300	N/A	INTRINSIC
low complexity region	368	389	N/A	INTRINSIC
low complexity region	434	443	N/A	INTRINSIC
low complexity region	499	514	N/A	INTRINSIC
low complexity region	634	648	N/A	INTRINSIC
VPS9	656	772	5.75e-38	SMART
RA	793	880	3.5e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000150795
AA Change: V97M

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000123268
Gene: ENSMUSG00000044456
AA Change: V97M

Domain	Start	End	E-Value	Type
low complexity region	20	32	N/A	INTRINSIC
Blast:SH2	61	122	1e-38	BLAST

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary: This protein encoded by this gene is a member of the RIN family of Ras interaction-interference proteins, which are binding partners to the RAB5 small GTPases. The protein functions as a guanine nucleotide exchange for RAB5B and RAB31. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Abca1	A	G	4: 53,132,963	I40T	probably benign	Het
Abca13	T	C	11: 9,277,035	V597A	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc1	A	G	2: 128,650,194		probably null	Het
Ap4e1	G	A	2: 127,037,864		probably null	Het
Apod	T	C	16: 31,311,091	T16A	probably benign	Het
Arrdc5	C	T	17: 56,300,138	V36M	probably damaging	Het
Bcan	A	G	3: 87,995,487	V328A	probably damaging	Het
Bche	A	G	3: 73,700,639	Y485H	probably damaging	Het
Btbd6	A	G	12: 112,978,136	Y356C	probably damaging	Het
Cdh4	A	G	2: 179,886,763	T555A	probably benign	Het
Ciita	C	T	16: 10,512,167	H769Y	probably damaging	Het
Clspn	A	G	4: 126,561,786	D35G	possibly damaging	Het
Cpsf3	T	A	12: 21,308,985	M562K	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cyp2a22	T	A	7: 26,936,433	Q235L	probably damaging	Het
Dicer1	A	G	12: 104,703,151	S1091P	probably damaging	Het
Dync1li1	T	A	9: 114,715,229	I323N	probably damaging	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat4	A	G	3: 38,888,005	N349S	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Hectd4	T	C	5: 121,310,603	M338T	probably benign	Het
Lactb2	A	T	1: 13,630,132	I225N	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mrps30	A	G	13: 118,387,162	S25P	probably benign	Het
Myg1	T	C	15: 102,337,824	V378A	probably benign	Het
Notch4	C	T	17: 34,587,123	T1731I	probably damaging	Het
Ntmt1	A	G	2: 30,820,648	D121G	probably damaging	Het
Olfr1167	A	T	2: 88,149,802	D72E	probably damaging	Het
Olfr763	C	A	10: 129,011,914	P210T	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pclo	A	G	5: 14,669,410	D1187G	unknown	Het
Pkd1	T	A	17: 24,565,073	Y198N	probably benign	Het
Plk4	T	A	3: 40,801,984	N83K	possibly damaging	Het
Prune2	A	T	19: 17,118,266	Q378L	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rasa1	G	T	13: 85,288,555	T118K	possibly damaging	Het
Rock2	T	C	12: 16,965,654		probably null	Het
Slc34a1	A	G	13: 55,403,268	I289V	probably benign	Het
Slc34a1	T	C	13: 55,412,290	L443P	probably damaging	Het
Slco2a1	A	T	9: 103,070,263	I254F	probably damaging	Het
Spink11	T	C	18: 44,195,686	I32V	probably benign	Het
Spire1	T	C	18: 67,506,555	E296G	probably damaging	Het
Sun1	A	G	5: 139,234,743	N410D	probably damaging	Het
Syt14	T	A	1: 192,930,663	T610S	possibly damaging	Het
Tenm3	T	C	8: 48,287,831	I1206V	possibly damaging	Het
Tet3	A	T	6: 83,376,764		probably null	Het
Thbs1	A	T	2: 118,122,666	Q919L	probably damaging	Het
Trappc10	A	G	10: 78,188,840	F1152L	possibly damaging	Het
Trp63	C	A	16: 25,863,718	N176K	probably damaging	Het
Zbtb17	A	G	4: 141,466,761	E700G	probably benign	Het
Zfp446	G	A	7: 12,978,057	R69H	probably benign	Het
Zfy2	C	T	Y: 2,106,555	C693Y	possibly damaging	Het
Zxdc	A	G	6: 90,382,146	T587A	probably damaging	Het
Zyg11a	A	G	4: 108,189,622	C552R	probably damaging	Het

Other mutations in Rin3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01394:Rin3	APN	12	102373603	missense	probably damaging	1.00
IGL01521:Rin3	APN	12	102369048	missense	probably benign	0.00
PIT4495001:Rin3	UTSW	12	102369036	missense	probably benign	0.02
R0109:Rin3	UTSW	12	102313081	missense	possibly damaging	0.74
R0109:Rin3	UTSW	12	102313081	missense	possibly damaging	0.74
R0504:Rin3	UTSW	12	102387564	nonsense	probably null
R0699:Rin3	UTSW	12	102369575	missense	probably damaging	0.98
R1499:Rin3	UTSW	12	102368759	missense	unknown
R1733:Rin3	UTSW	12	102369330	nonsense	probably null
R1743:Rin3	UTSW	12	102390096	missense	possibly damaging	0.87
R2911:Rin3	UTSW	12	102373584	missense	probably benign	0.43
R2961:Rin3	UTSW	12	102313046	nonsense	probably null
R3153:Rin3	UTSW	12	102368541	missense	unknown
R3932:Rin3	UTSW	12	102390083	missense	probably damaging	0.98
R4498:Rin3	UTSW	12	102369680	missense	probably damaging	1.00
R4803:Rin3	UTSW	12	102361383	intron	probably benign
R4985:Rin3	UTSW	12	102368562	missense	unknown
R5300:Rin3	UTSW	12	102369670	missense	probably benign	0.29
R5414:Rin3	UTSW	12	102389857	nonsense	probably null
R5458:Rin3	UTSW	12	102373716	missense	probably damaging	0.99
R5503:Rin3	UTSW	12	102313055	missense	probably benign	0.17
R5534:Rin3	UTSW	12	102387632	missense	probably damaging	1.00
R5599:Rin3	UTSW	12	102389929	missense	probably damaging	1.00
R5752:Rin3	UTSW	12	102313119	start gained	probably benign
R5874:Rin3	UTSW	12	102389843	missense	probably damaging	1.00
R6467:Rin3	UTSW	12	102369325	missense	probably benign	0.06
R7250:Rin3	UTSW	12	102368634	missense	unknown
R7264:Rin3	UTSW	12	102390115	missense	probably benign	0.01
R7514:Rin3	UTSW	12	102369650	nonsense	probably null
R7534:Rin3	UTSW	12	102350941	missense	unknown
R7837:Rin3	UTSW	12	102368765	missense	unknown
R7875:Rin3	UTSW	12	102369476	missense	probably damaging	1.00
R7983:Rin3	UTSW	12	102369159	missense	probably benign	0.14
R8014:Rin3	UTSW	12	102361371	nonsense	probably null
R8187:Rin3	UTSW	12	102325807	missense	unknown
R8757:Rin3	UTSW	12	102373602	missense	probably damaging	1.00
R8759:Rin3	UTSW	12	102373602	missense	probably damaging	1.00
R8841:Rin3	UTSW	12	102369278	missense	probably benign	0.16
R8843:Rin3	UTSW	12	102369598	missense	probably benign	0.08
R9050:Rin3	UTSW	12	102369479	missense	probably damaging	1.00
R9197:Rin3	UTSW	12	102369047	missense	probably benign	0.03
R9272:Rin3	UTSW	12	102369432	missense	probably damaging	1.00
R9424:Rin3	UTSW	12	102369330	nonsense	probably null
R9517:Rin3	UTSW	12	102368636	missense	unknown
R9576:Rin3	UTSW	12	102369330	nonsense	probably null
Z1177:Rin3	UTSW	12	102325862	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGCGTAGACTCAGTGCAAATG -3'
(R):5'- AAACTGCTACCTTGGAGCC -3'

Sequencing Primer
(F):5'- TGAGAAATGGAGACTTGAGGATCTC -3'
(R):5'- GGAGCCAACCCTAAAATTGATTTTCC -3'

Posted On

2016-08-04