Mutagenetix > Incidental Mutation

Incidental Mutation 'R5363:Dicer1'

422946

Institutional Source

Beutler Lab

Gene Symbol

Dicer1

Ensembl Gene

ENSMUSG00000041415

Gene Name

dicer 1, ribonuclease type III

Synonyms

D12Ertd7e

MMRRC Submission

042941-MU

Accession Numbers

Ncbi RefSeq: NM_148948.2; MGI:2177178

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5363 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104687742-104751952 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 104703151 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1091 (S1091P)

Ref Sequence

ENSEMBL: ENSMUSP00000043676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041987]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000041987
AA Change: S1091P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: S1091P

Domain	Start	End	E-Value	Type
DEXDc	30	233	5.14e-24	SMART
low complexity region	403	419	N/A	INTRINSIC
HELICc	449	546	3.15e-10	SMART
Pfam:Dicer_dimer	620	707	1.4e-25	PFAM
low complexity region	713	723	N/A	INTRINSIC
PAZ	881	1056	1.67e-48	SMART
Blast:PAZ	1080	1129	2e-8	BLAST
RIBOc	1285	1582	1.83e-35	SMART
RIBOc	1665	1831	5.97e-49	SMART
DSRM	1834	1897	6.89e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222115

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222519

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222528

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

Strain: 3589209; 3809262; 2681012; 3576927
Lethality: E7-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Abca1	A	G	4: 53,132,963	I40T	probably benign	Het
Abca13	T	C	11: 9,277,035	V597A	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc1	A	G	2: 128,650,194		probably null	Het
Ap4e1	G	A	2: 127,037,864		probably null	Het
Apod	T	C	16: 31,311,091	T16A	probably benign	Het
Arrdc5	C	T	17: 56,300,138	V36M	probably damaging	Het
Bcan	A	G	3: 87,995,487	V328A	probably damaging	Het
Bche	A	G	3: 73,700,639	Y485H	probably damaging	Het
Btbd6	A	G	12: 112,978,136	Y356C	probably damaging	Het
Cdh4	A	G	2: 179,886,763	T555A	probably benign	Het
Ciita	C	T	16: 10,512,167	H769Y	probably damaging	Het
Clspn	A	G	4: 126,561,786	D35G	possibly damaging	Het
Cpsf3	T	A	12: 21,308,985	M562K	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cyp2a22	T	A	7: 26,936,433	Q235L	probably damaging	Het
Dync1li1	T	A	9: 114,715,229	I323N	probably damaging	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat4	A	G	3: 38,888,005	N349S	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Hectd4	T	C	5: 121,310,603	M338T	probably benign	Het
Lactb2	A	T	1: 13,630,132	I225N	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mrps30	A	G	13: 118,387,162	S25P	probably benign	Het
Myg1	T	C	15: 102,337,824	V378A	probably benign	Het
Notch4	C	T	17: 34,587,123	T1731I	probably damaging	Het
Ntmt1	A	G	2: 30,820,648	D121G	probably damaging	Het
Olfr1167	A	T	2: 88,149,802	D72E	probably damaging	Het
Olfr763	C	A	10: 129,011,914	P210T	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pclo	A	G	5: 14,669,410	D1187G	unknown	Het
Pkd1	T	A	17: 24,565,073	Y198N	probably benign	Het
Plk4	T	A	3: 40,801,984	N83K	possibly damaging	Het
Prune2	A	T	19: 17,118,266	Q378L	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rasa1	G	T	13: 85,288,555	T118K	possibly damaging	Het
Rin3	G	A	12: 102,325,834	V97M	probably damaging	Het
Rock2	T	C	12: 16,965,654		probably null	Het
Slc34a1	A	G	13: 55,403,268	I289V	probably benign	Het
Slc34a1	T	C	13: 55,412,290	L443P	probably damaging	Het
Slco2a1	A	T	9: 103,070,263	I254F	probably damaging	Het
Spink11	T	C	18: 44,195,686	I32V	probably benign	Het
Spire1	T	C	18: 67,506,555	E296G	probably damaging	Het
Sun1	A	G	5: 139,234,743	N410D	probably damaging	Het
Syt14	T	A	1: 192,930,663	T610S	possibly damaging	Het
Tenm3	T	C	8: 48,287,831	I1206V	possibly damaging	Het
Tet3	A	T	6: 83,376,764		probably null	Het
Thbs1	A	T	2: 118,122,666	Q919L	probably damaging	Het
Trappc10	A	G	10: 78,188,840	F1152L	possibly damaging	Het
Trp63	C	A	16: 25,863,718	N176K	probably damaging	Het
Zbtb17	A	G	4: 141,466,761	E700G	probably benign	Het
Zfp446	G	A	7: 12,978,057	R69H	probably benign	Het
Zfy2	C	T	Y: 2,106,555	C693Y	possibly damaging	Het
Zxdc	A	G	6: 90,382,146	T587A	probably damaging	Het
Zyg11a	A	G	4: 108,189,622	C552R	probably damaging	Het

Other mutations in Dicer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Dicer1	APN	12	104696772	missense	possibly damaging	0.93
IGL01061:Dicer1	APN	12	104706327	missense	probably null	0.75
IGL01527:Dicer1	APN	12	104691610	nonsense	probably null
IGL01597:Dicer1	APN	12	104705210	nonsense	probably null
IGL01636:Dicer1	APN	12	104722241	missense	probably damaging	1.00
IGL01717:Dicer1	APN	12	104702787	nonsense	probably null
IGL01765:Dicer1	APN	12	104706740	missense	probably damaging	1.00
IGL01871:Dicer1	APN	12	104704180	missense	probably damaging	1.00
IGL02316:Dicer1	APN	12	104702553	missense	probably damaging	1.00
IGL02317:Dicer1	APN	12	104697020	missense	probably damaging	1.00
IGL02539:Dicer1	APN	12	104697035	missense	probably damaging	0.97
IGL02544:Dicer1	APN	12	104714832	missense	probably damaging	1.00
IGL02664:Dicer1	APN	12	104705129	missense	probably damaging	1.00
IGL02667:Dicer1	APN	12	104714906	missense	probably damaging	1.00
IGL03353:Dicer1	APN	12	104713107	missense	probably damaging	1.00
IGL03377:Dicer1	APN	12	104712197	missense	probably damaging	0.98
everest	UTSW	12	104705128	missense	probably damaging	1.00
PIT4480001:Dicer1	UTSW	12	104696544	missense	probably benign
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0219:Dicer1	UTSW	12	104692125	critical splice donor site	probably null
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0385:Dicer1	UTSW	12	104704174	missense	probably damaging	1.00
R0402:Dicer1	UTSW	12	104731064	missense	probably benign	0.04
R0426:Dicer1	UTSW	12	104702542	missense	probably damaging	1.00
R0453:Dicer1	UTSW	12	104702630	missense	probably benign
R0502:Dicer1	UTSW	12	104705060	missense	probably damaging	1.00
R0507:Dicer1	UTSW	12	104691658	missense	probably damaging	1.00
R0511:Dicer1	UTSW	12	104702841	missense	possibly damaging	0.95
R0523:Dicer1	UTSW	12	104702491	missense	probably damaging	1.00
R0559:Dicer1	UTSW	12	104706301	missense	probably damaging	1.00
R0600:Dicer1	UTSW	12	104706864	missense	probably damaging	1.00
R0707:Dicer1	UTSW	12	104706885	missense	probably damaging	1.00
R1225:Dicer1	UTSW	12	104691607	missense	probably damaging	0.98
R1351:Dicer1	UTSW	12	104729142	missense	probably damaging	0.99
R1449:Dicer1	UTSW	12	104729243	missense	possibly damaging	0.85
R1575:Dicer1	UTSW	12	104721969	critical splice donor site	probably null
R1642:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R1651:Dicer1	UTSW	12	104708805	missense	probably damaging	1.00
R1658:Dicer1	UTSW	12	104700414	missense	probably benign
R1815:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1816:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1927:Dicer1	UTSW	12	104702884	missense	possibly damaging	0.91
R2113:Dicer1	UTSW	12	104713214	missense	probably damaging	1.00
R2129:Dicer1	UTSW	12	104722031	missense	probably damaging	1.00
R2157:Dicer1	UTSW	12	104702949	missense	probably benign	0.17
R2202:Dicer1	UTSW	12	104731038	missense	possibly damaging	0.95
R2203:Dicer1	UTSW	12	104731038	missense	possibly damaging	0.95
R2243:Dicer1	UTSW	12	104730188	missense	probably damaging	0.99
R4237:Dicer1	UTSW	12	104729228	missense	possibly damaging	0.48
R4419:Dicer1	UTSW	12	104705114	missense	probably damaging	1.00
R4482:Dicer1	UTSW	12	104706277	missense	probably damaging	1.00
R4564:Dicer1	UTSW	12	104704751	nonsense	probably null
R4776:Dicer1	UTSW	12	104692446	missense	probably damaging	0.99
R4834:Dicer1	UTSW	12	104696591	missense	probably benign	0.44
R4904:Dicer1	UTSW	12	104713066	missense	probably benign
R5202:Dicer1	UTSW	12	104694731	nonsense	probably null
R5272:Dicer1	UTSW	12	104704240	missense	probably damaging	1.00
R5717:Dicer1	UTSW	12	104705128	missense	probably damaging	1.00
R6381:Dicer1	UTSW	12	104696462	missense	probably benign	0.00
R6479:Dicer1	UTSW	12	104696723	missense	probably damaging	0.97
R6956:Dicer1	UTSW	12	104731023	missense	probably damaging	1.00
R7234:Dicer1	UTSW	12	104708849	missense	probably damaging	1.00
R7401:Dicer1	UTSW	12	104712278	missense	probably benign
R7407:Dicer1	UTSW	12	104722351	nonsense	probably null
R7471:Dicer1	UTSW	12	104694710	missense	probably damaging	1.00
R7699:Dicer1	UTSW	12	104705170	missense	probably damaging	1.00
R7768:Dicer1	UTSW	12	104706697	missense	probably damaging	0.99
R7831:Dicer1	UTSW	12	104708800	missense	probably damaging	1.00
R7998:Dicer1	UTSW	12	104704069	missense	probably damaging	1.00
R8010:Dicer1	UTSW	12	104692132	missense	probably damaging	0.99
R8061:Dicer1	UTSW	12	104702818	nonsense	probably null
R8213:Dicer1	UTSW	12	104702693	missense	probably benign	0.00
R8261:Dicer1	UTSW	12	104691606	missense	probably damaging	1.00
R8419:Dicer1	UTSW	12	104702677	missense	probably benign	0.00
R8708:Dicer1	UTSW	12	104728445	missense	possibly damaging	0.65
R8851:Dicer1	UTSW	12	104724041	missense	possibly damaging	0.76
R9220:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R9371:Dicer1	UTSW	12	104704732	missense	probably damaging	1.00
R9387:Dicer1	UTSW	12	104729240	missense	possibly damaging	0.48
R9505:Dicer1	UTSW	12	104731038	missense	possibly damaging	0.95
R9636:Dicer1	UTSW	12	104722147	nonsense	probably null
R9682:Dicer1	UTSW	12	104706225	missense	probably damaging	1.00
X0018:Dicer1	UTSW	12	104696934	missense	probably benign	0.00
Z1176:Dicer1	UTSW	12	104731020	missense	probably null	0.97

Predicted Primers

PCR Primer
(F):5'- TTGGAGCTTAGCAGGTGACTC -3'
(R):5'- ATTAGAACCGACTGTGTGCAGAG -3'

Sequencing Primer
(F):5'- TTAGCAGGTGACTCAGCGG -3'
(R):5'- ACTGTGTGCAGAGTCCCAG -3'

Posted On

2016-08-04