Incidental Mutation 'R5363:Dicer1'
ID 422946
Institutional Source Beutler Lab
Gene Symbol Dicer1
Ensembl Gene ENSMUSG00000041415
Gene Name dicer 1, ribonuclease type III
Synonyms D12Ertd7e, Dicer1, 1110006F08Rik
MMRRC Submission 042941-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5363 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 104654001-104718211 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104669410 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1091 (S1091P)
Ref Sequence ENSEMBL: ENSMUSP00000043676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041987]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000041987
AA Change: S1091P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: S1091P

DomainStartEndE-ValueType
DEXDc 30 233 5.14e-24 SMART
low complexity region 403 419 N/A INTRINSIC
HELICc 449 546 3.15e-10 SMART
Pfam:Dicer_dimer 620 707 1.4e-25 PFAM
low complexity region 713 723 N/A INTRINSIC
PAZ 881 1056 1.67e-48 SMART
Blast:PAZ 1080 1129 2e-8 BLAST
RIBOc 1285 1582 1.83e-35 SMART
RIBOc 1665 1831 5.97e-49 SMART
DSRM 1834 1897 6.89e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222528
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,132,963 (GRCm39) I40T probably benign Het
Abca13 T C 11: 9,227,035 (GRCm39) V597A possibly damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Anapc1 A G 2: 128,492,114 (GRCm39) probably null Het
Ap4e1 G A 2: 126,879,784 (GRCm39) probably null Het
Apod T C 16: 31,129,909 (GRCm39) T16A probably benign Het
Arrdc5 C T 17: 56,607,138 (GRCm39) V36M probably damaging Het
Bcan A G 3: 87,902,794 (GRCm39) V328A probably damaging Het
Bche A G 3: 73,607,972 (GRCm39) Y485H probably damaging Het
Btbd6 A G 12: 112,941,756 (GRCm39) Y356C probably damaging Het
Cdh4 A G 2: 179,528,556 (GRCm39) T555A probably benign Het
Ciita C T 16: 10,330,031 (GRCm39) H769Y probably damaging Het
Clspn A G 4: 126,455,579 (GRCm39) D35G possibly damaging Het
Cpsf3 T A 12: 21,358,986 (GRCm39) M562K probably benign Het
Cstdc1 G T 2: 148,625,298 (GRCm39) L77F probably damaging Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,759,803 (GRCm39) probably null Het
Cyp2a22 T A 7: 26,635,858 (GRCm39) Q235L probably damaging Het
Dync1li1 T A 9: 114,544,297 (GRCm39) I323N probably damaging Het
Fat4 A G 3: 38,942,154 (GRCm39) N349S probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Hectd4 T C 5: 121,448,666 (GRCm39) M338T probably benign Het
Insyn2b G A 11: 34,352,788 (GRCm39) E277K probably damaging Het
Lactb2 A T 1: 13,700,356 (GRCm39) I225N probably benign Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Mrps30 A G 13: 118,523,698 (GRCm39) S25P probably benign Het
Myg1 T C 15: 102,246,259 (GRCm39) V378A probably benign Het
Notch4 C T 17: 34,806,097 (GRCm39) T1731I probably damaging Het
Ntmt1 A G 2: 30,710,660 (GRCm39) D121G probably damaging Het
Or10p21 C A 10: 128,847,783 (GRCm39) P210T probably damaging Het
Or5d39 A T 2: 87,980,146 (GRCm39) D72E probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pclo A G 5: 14,719,424 (GRCm39) D1187G unknown Het
Pkd1 T A 17: 24,784,047 (GRCm39) Y198N probably benign Het
Plk4 T A 3: 40,756,419 (GRCm39) N83K possibly damaging Het
Prune2 A T 19: 17,095,630 (GRCm39) Q378L probably damaging Het
R3hdm4 C T 10: 79,748,292 (GRCm39) E162K possibly damaging Het
Rasa1 G T 13: 85,436,674 (GRCm39) T118K possibly damaging Het
Rin3 G A 12: 102,292,093 (GRCm39) V97M probably damaging Het
Rock2 T C 12: 17,015,655 (GRCm39) probably null Het
Slc34a1 A G 13: 55,551,081 (GRCm39) I289V probably benign Het
Slc34a1 T C 13: 55,560,103 (GRCm39) L443P probably damaging Het
Slco2a1 A T 9: 102,947,462 (GRCm39) I254F probably damaging Het
Spink11 T C 18: 44,328,753 (GRCm39) I32V probably benign Het
Spire1 T C 18: 67,639,625 (GRCm39) E296G probably damaging Het
Sun1 A G 5: 139,220,498 (GRCm39) N410D probably damaging Het
Syt14 T A 1: 192,612,971 (GRCm39) T610S possibly damaging Het
Tenm3 T C 8: 48,740,866 (GRCm39) I1206V possibly damaging Het
Tet3 A T 6: 83,353,746 (GRCm39) probably null Het
Thbs1 A T 2: 117,953,147 (GRCm39) Q919L probably damaging Het
Trappc10 A G 10: 78,024,674 (GRCm39) F1152L possibly damaging Het
Trp63 C A 16: 25,682,468 (GRCm39) N176K probably damaging Het
Zbtb17 A G 4: 141,194,072 (GRCm39) E700G probably benign Het
Zfp446 G A 7: 12,711,984 (GRCm39) R69H probably benign Het
Zfy2 C T Y: 2,106,555 (GRCm39) C693Y possibly damaging Het
Zxdc A G 6: 90,359,128 (GRCm39) T587A probably damaging Het
Zyg11a A G 4: 108,046,819 (GRCm39) C552R probably damaging Het
Other mutations in Dicer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Dicer1 APN 12 104,663,031 (GRCm39) missense possibly damaging 0.93
IGL01061:Dicer1 APN 12 104,672,586 (GRCm39) missense probably null 0.75
IGL01527:Dicer1 APN 12 104,657,869 (GRCm39) nonsense probably null
IGL01597:Dicer1 APN 12 104,671,469 (GRCm39) nonsense probably null
IGL01636:Dicer1 APN 12 104,688,500 (GRCm39) missense probably damaging 1.00
IGL01717:Dicer1 APN 12 104,669,046 (GRCm39) nonsense probably null
IGL01765:Dicer1 APN 12 104,672,999 (GRCm39) missense probably damaging 1.00
IGL01871:Dicer1 APN 12 104,670,439 (GRCm39) missense probably damaging 1.00
IGL02316:Dicer1 APN 12 104,668,812 (GRCm39) missense probably damaging 1.00
IGL02317:Dicer1 APN 12 104,663,279 (GRCm39) missense probably damaging 1.00
IGL02539:Dicer1 APN 12 104,663,294 (GRCm39) missense probably damaging 0.97
IGL02544:Dicer1 APN 12 104,681,091 (GRCm39) missense probably damaging 1.00
IGL02664:Dicer1 APN 12 104,671,388 (GRCm39) missense probably damaging 1.00
IGL02667:Dicer1 APN 12 104,681,165 (GRCm39) missense probably damaging 1.00
IGL03353:Dicer1 APN 12 104,679,366 (GRCm39) missense probably damaging 1.00
IGL03377:Dicer1 APN 12 104,678,456 (GRCm39) missense probably damaging 0.98
everest UTSW 12 104,671,387 (GRCm39) missense probably damaging 1.00
PIT4480001:Dicer1 UTSW 12 104,662,803 (GRCm39) missense probably benign
R0032:Dicer1 UTSW 12 104,671,057 (GRCm39) nonsense probably null
R0032:Dicer1 UTSW 12 104,671,057 (GRCm39) nonsense probably null
R0219:Dicer1 UTSW 12 104,658,384 (GRCm39) critical splice donor site probably null
R0242:Dicer1 UTSW 12 104,668,710 (GRCm39) missense probably benign 0.02
R0242:Dicer1 UTSW 12 104,668,710 (GRCm39) missense probably benign 0.02
R0385:Dicer1 UTSW 12 104,670,433 (GRCm39) missense probably damaging 1.00
R0402:Dicer1 UTSW 12 104,697,323 (GRCm39) missense probably benign 0.04
R0426:Dicer1 UTSW 12 104,668,801 (GRCm39) missense probably damaging 1.00
R0453:Dicer1 UTSW 12 104,668,889 (GRCm39) missense probably benign
R0502:Dicer1 UTSW 12 104,671,319 (GRCm39) missense probably damaging 1.00
R0507:Dicer1 UTSW 12 104,657,917 (GRCm39) missense probably damaging 1.00
R0511:Dicer1 UTSW 12 104,669,100 (GRCm39) missense possibly damaging 0.95
R0523:Dicer1 UTSW 12 104,668,750 (GRCm39) missense probably damaging 1.00
R0559:Dicer1 UTSW 12 104,672,560 (GRCm39) missense probably damaging 1.00
R0600:Dicer1 UTSW 12 104,673,123 (GRCm39) missense probably damaging 1.00
R0707:Dicer1 UTSW 12 104,673,144 (GRCm39) missense probably damaging 1.00
R1225:Dicer1 UTSW 12 104,657,866 (GRCm39) missense probably damaging 0.98
R1351:Dicer1 UTSW 12 104,695,401 (GRCm39) missense probably damaging 0.99
R1449:Dicer1 UTSW 12 104,695,502 (GRCm39) missense possibly damaging 0.85
R1575:Dicer1 UTSW 12 104,688,228 (GRCm39) critical splice donor site probably null
R1642:Dicer1 UTSW 12 104,679,415 (GRCm39) missense probably damaging 1.00
R1651:Dicer1 UTSW 12 104,675,064 (GRCm39) missense probably damaging 1.00
R1658:Dicer1 UTSW 12 104,666,673 (GRCm39) missense probably benign
R1815:Dicer1 UTSW 12 104,688,410 (GRCm39) missense probably damaging 1.00
R1816:Dicer1 UTSW 12 104,688,410 (GRCm39) missense probably damaging 1.00
R1927:Dicer1 UTSW 12 104,669,143 (GRCm39) missense possibly damaging 0.91
R2113:Dicer1 UTSW 12 104,679,473 (GRCm39) missense probably damaging 1.00
R2129:Dicer1 UTSW 12 104,688,290 (GRCm39) missense probably damaging 1.00
R2157:Dicer1 UTSW 12 104,669,208 (GRCm39) missense probably benign 0.17
R2202:Dicer1 UTSW 12 104,697,297 (GRCm39) missense possibly damaging 0.95
R2203:Dicer1 UTSW 12 104,697,297 (GRCm39) missense possibly damaging 0.95
R2243:Dicer1 UTSW 12 104,696,447 (GRCm39) missense probably damaging 0.99
R4237:Dicer1 UTSW 12 104,695,487 (GRCm39) missense possibly damaging 0.48
R4419:Dicer1 UTSW 12 104,671,373 (GRCm39) missense probably damaging 1.00
R4482:Dicer1 UTSW 12 104,672,536 (GRCm39) missense probably damaging 1.00
R4564:Dicer1 UTSW 12 104,671,010 (GRCm39) nonsense probably null
R4776:Dicer1 UTSW 12 104,658,705 (GRCm39) missense probably damaging 0.99
R4834:Dicer1 UTSW 12 104,662,850 (GRCm39) missense probably benign 0.44
R4904:Dicer1 UTSW 12 104,679,325 (GRCm39) missense probably benign
R5202:Dicer1 UTSW 12 104,660,990 (GRCm39) nonsense probably null
R5272:Dicer1 UTSW 12 104,670,499 (GRCm39) missense probably damaging 1.00
R5717:Dicer1 UTSW 12 104,671,387 (GRCm39) missense probably damaging 1.00
R6381:Dicer1 UTSW 12 104,662,721 (GRCm39) missense probably benign 0.00
R6479:Dicer1 UTSW 12 104,662,982 (GRCm39) missense probably damaging 0.97
R6956:Dicer1 UTSW 12 104,697,282 (GRCm39) missense probably damaging 1.00
R7234:Dicer1 UTSW 12 104,675,108 (GRCm39) missense probably damaging 1.00
R7401:Dicer1 UTSW 12 104,678,537 (GRCm39) missense probably benign
R7407:Dicer1 UTSW 12 104,688,610 (GRCm39) nonsense probably null
R7471:Dicer1 UTSW 12 104,660,969 (GRCm39) missense probably damaging 1.00
R7699:Dicer1 UTSW 12 104,671,429 (GRCm39) missense probably damaging 1.00
R7768:Dicer1 UTSW 12 104,672,956 (GRCm39) missense probably damaging 0.99
R7831:Dicer1 UTSW 12 104,675,059 (GRCm39) missense probably damaging 1.00
R7998:Dicer1 UTSW 12 104,670,328 (GRCm39) missense probably damaging 1.00
R8010:Dicer1 UTSW 12 104,658,391 (GRCm39) missense probably damaging 0.99
R8061:Dicer1 UTSW 12 104,669,077 (GRCm39) nonsense probably null
R8213:Dicer1 UTSW 12 104,668,952 (GRCm39) missense probably benign 0.00
R8261:Dicer1 UTSW 12 104,657,865 (GRCm39) missense probably damaging 1.00
R8419:Dicer1 UTSW 12 104,668,936 (GRCm39) missense probably benign 0.00
R8708:Dicer1 UTSW 12 104,694,704 (GRCm39) missense possibly damaging 0.65
R8851:Dicer1 UTSW 12 104,690,300 (GRCm39) missense possibly damaging 0.76
R9220:Dicer1 UTSW 12 104,679,415 (GRCm39) missense probably damaging 1.00
R9371:Dicer1 UTSW 12 104,670,991 (GRCm39) missense probably damaging 1.00
R9387:Dicer1 UTSW 12 104,695,499 (GRCm39) missense possibly damaging 0.48
R9505:Dicer1 UTSW 12 104,697,297 (GRCm39) missense possibly damaging 0.95
R9636:Dicer1 UTSW 12 104,688,406 (GRCm39) nonsense probably null
R9682:Dicer1 UTSW 12 104,672,484 (GRCm39) missense probably damaging 1.00
X0018:Dicer1 UTSW 12 104,663,193 (GRCm39) missense probably benign 0.00
Z1176:Dicer1 UTSW 12 104,697,279 (GRCm39) missense probably null 0.97
Predicted Primers PCR Primer
(F):5'- TTGGAGCTTAGCAGGTGACTC -3'
(R):5'- ATTAGAACCGACTGTGTGCAGAG -3'

Sequencing Primer
(F):5'- TTAGCAGGTGACTCAGCGG -3'
(R):5'- ACTGTGTGCAGAGTCCCAG -3'
Posted On 2016-08-04