Incidental Mutation 'R5363:Btbd6'
ID 422947
Institutional Source Beutler Lab
Gene Symbol Btbd6
Ensembl Gene ENSMUSG00000002803
Gene Name BTB domain containing 6
Synonyms
MMRRC Submission 042941-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.277) question?
Stock # R5363 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 112940102-112942565 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 112941756 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 356 (Y356C)
Ref Sequence ENSEMBL: ENSMUSP00000152889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002880] [ENSMUST00000011302] [ENSMUST00000165079] [ENSMUST00000221104] [ENSMUST00000221500] [ENSMUST00000223287] [ENSMUST00000222209] [ENSMUST00000223368]
AlphaFold Q8K2J9
Predicted Effect probably damaging
Transcript: ENSMUST00000002880
AA Change: Y407C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002880
Gene: ENSMUSG00000002803
AA Change: Y407C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 40 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
low complexity region 58 68 N/A INTRINSIC
low complexity region 86 106 N/A INTRINSIC
BTB 137 237 1.39e-23 SMART
BACK 243 352 2.81e-14 SMART
Pfam:PHR 393 538 1.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000011302
SMART Domains Protein: ENSMUSP00000011302
Gene: ENSMUSG00000011158

DomainStartEndE-ValueType
Pfam:TF_Zn_Ribbon 4 46 4.3e-17 PFAM
CYCLIN 91 172 1.93e-12 SMART
CYCLIN 185 269 1.22e-9 SMART
coiled coil region 298 334 N/A INTRINSIC
low complexity region 362 374 N/A INTRINSIC
low complexity region 431 444 N/A INTRINSIC
Pfam:BRF1 452 545 3.3e-29 PFAM
low complexity region 638 650 N/A INTRINSIC
low complexity region 662 675 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165079
AA Change: Y356C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127286
Gene: ENSMUSG00000002803
AA Change: Y356C

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 35 55 N/A INTRINSIC
BTB 86 186 1.39e-23 SMART
BACK 192 301 2.81e-14 SMART
Pfam:PHR 342 488 8.7e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220567
Predicted Effect probably damaging
Transcript: ENSMUST00000221104
AA Change: Y356C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221415
Predicted Effect probably benign
Transcript: ENSMUST00000223508
Predicted Effect probably benign
Transcript: ENSMUST00000221500
Predicted Effect probably benign
Transcript: ENSMUST00000223287
Predicted Effect probably benign
Transcript: ENSMUST00000222209
Predicted Effect probably benign
Transcript: ENSMUST00000223368
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,132,963 (GRCm39) I40T probably benign Het
Abca13 T C 11: 9,227,035 (GRCm39) V597A possibly damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Anapc1 A G 2: 128,492,114 (GRCm39) probably null Het
Ap4e1 G A 2: 126,879,784 (GRCm39) probably null Het
Apod T C 16: 31,129,909 (GRCm39) T16A probably benign Het
Arrdc5 C T 17: 56,607,138 (GRCm39) V36M probably damaging Het
Bcan A G 3: 87,902,794 (GRCm39) V328A probably damaging Het
Bche A G 3: 73,607,972 (GRCm39) Y485H probably damaging Het
Cdh4 A G 2: 179,528,556 (GRCm39) T555A probably benign Het
Ciita C T 16: 10,330,031 (GRCm39) H769Y probably damaging Het
Clspn A G 4: 126,455,579 (GRCm39) D35G possibly damaging Het
Cpsf3 T A 12: 21,358,986 (GRCm39) M562K probably benign Het
Cstdc1 G T 2: 148,625,298 (GRCm39) L77F probably damaging Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,759,803 (GRCm39) probably null Het
Cyp2a22 T A 7: 26,635,858 (GRCm39) Q235L probably damaging Het
Dicer1 A G 12: 104,669,410 (GRCm39) S1091P probably damaging Het
Dync1li1 T A 9: 114,544,297 (GRCm39) I323N probably damaging Het
Fat4 A G 3: 38,942,154 (GRCm39) N349S probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Hectd4 T C 5: 121,448,666 (GRCm39) M338T probably benign Het
Insyn2b G A 11: 34,352,788 (GRCm39) E277K probably damaging Het
Lactb2 A T 1: 13,700,356 (GRCm39) I225N probably benign Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Mrps30 A G 13: 118,523,698 (GRCm39) S25P probably benign Het
Myg1 T C 15: 102,246,259 (GRCm39) V378A probably benign Het
Notch4 C T 17: 34,806,097 (GRCm39) T1731I probably damaging Het
Ntmt1 A G 2: 30,710,660 (GRCm39) D121G probably damaging Het
Or10p21 C A 10: 128,847,783 (GRCm39) P210T probably damaging Het
Or5d39 A T 2: 87,980,146 (GRCm39) D72E probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pclo A G 5: 14,719,424 (GRCm39) D1187G unknown Het
Pkd1 T A 17: 24,784,047 (GRCm39) Y198N probably benign Het
Plk4 T A 3: 40,756,419 (GRCm39) N83K possibly damaging Het
Prune2 A T 19: 17,095,630 (GRCm39) Q378L probably damaging Het
R3hdm4 C T 10: 79,748,292 (GRCm39) E162K possibly damaging Het
Rasa1 G T 13: 85,436,674 (GRCm39) T118K possibly damaging Het
Rin3 G A 12: 102,292,093 (GRCm39) V97M probably damaging Het
Rock2 T C 12: 17,015,655 (GRCm39) probably null Het
Slc34a1 A G 13: 55,551,081 (GRCm39) I289V probably benign Het
Slc34a1 T C 13: 55,560,103 (GRCm39) L443P probably damaging Het
Slco2a1 A T 9: 102,947,462 (GRCm39) I254F probably damaging Het
Spink11 T C 18: 44,328,753 (GRCm39) I32V probably benign Het
Spire1 T C 18: 67,639,625 (GRCm39) E296G probably damaging Het
Sun1 A G 5: 139,220,498 (GRCm39) N410D probably damaging Het
Syt14 T A 1: 192,612,971 (GRCm39) T610S possibly damaging Het
Tenm3 T C 8: 48,740,866 (GRCm39) I1206V possibly damaging Het
Tet3 A T 6: 83,353,746 (GRCm39) probably null Het
Thbs1 A T 2: 117,953,147 (GRCm39) Q919L probably damaging Het
Trappc10 A G 10: 78,024,674 (GRCm39) F1152L possibly damaging Het
Trp63 C A 16: 25,682,468 (GRCm39) N176K probably damaging Het
Zbtb17 A G 4: 141,194,072 (GRCm39) E700G probably benign Het
Zfp446 G A 7: 12,711,984 (GRCm39) R69H probably benign Het
Zfy2 C T Y: 2,106,555 (GRCm39) C693Y possibly damaging Het
Zxdc A G 6: 90,359,128 (GRCm39) T587A probably damaging Het
Zyg11a A G 4: 108,046,819 (GRCm39) C552R probably damaging Het
Other mutations in Btbd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02264:Btbd6 APN 12 112,940,589 (GRCm39) missense probably damaging 1.00
IGL03098:Btbd6 UTSW 12 112,942,038 (GRCm39) missense probably damaging 1.00
R0544:Btbd6 UTSW 12 112,940,702 (GRCm39) missense probably damaging 1.00
R2065:Btbd6 UTSW 12 112,941,755 (GRCm39) missense probably damaging 1.00
R2424:Btbd6 UTSW 12 112,941,980 (GRCm39) missense probably benign 0.00
R4241:Btbd6 UTSW 12 112,940,416 (GRCm39) missense probably benign
R6478:Btbd6 UTSW 12 112,940,932 (GRCm39) unclassified probably benign
R7063:Btbd6 UTSW 12 112,941,132 (GRCm39) missense probably damaging 1.00
R8901:Btbd6 UTSW 12 112,940,220 (GRCm39) unclassified probably benign
R9741:Btbd6 UTSW 12 112,940,923 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACCTGGTCCGAATTCCAAC -3'
(R):5'- AAAGTGTTGCTGGATCCGTC -3'

Sequencing Primer
(F):5'- GGTCCGAATTCCAACTATGACCTTAG -3'
(R):5'- CTGGATCCGTCTGAAACAAACTTGG -3'
Posted On 2016-08-04