Incidental Mutation 'R5363:Slc34a1'
ID422948
Institutional Source Beutler Lab
Gene Symbol Slc34a1
Ensembl Gene ENSMUSG00000021490
Gene Namesolute carrier family 34 (sodium phosphate), member 1
SynonymsNa/Pi cotransporter, Npt2, NaPi-IIa, Slc17a2, renal Na+/Pi transporter
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5363 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location55398187-55415592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55403268 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 289 (I289V)
Ref Sequence ENSEMBL: ENSMUSP00000153038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057167] [ENSMUST00000224925] [ENSMUST00000225259]
Predicted Effect probably benign
Transcript: ENSMUST00000057167
AA Change: I289V

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000059138
Gene: ENSMUSG00000021490
AA Change: I289V

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 113 256 7.4e-28 PFAM
Pfam:Na_Pi_cotrans 359 549 2.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224043
Predicted Effect probably benign
Transcript: ENSMUST00000224925
AA Change: I170V

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000225259
AA Change: I289V

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II sodium-phosphate cotransporter family. Mutations in this gene are associated with hypophosphatemia nephrolithiasis/osteoporosis 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice exhibit renal phosphate wasting, hyerpcalciuria, and skeletal abnormalities. Postnatal viability is reduced, putatively due to poor nutritional status. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Slc34a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Slc34a1 APN 13 55409071 missense probably damaging 1.00
IGL01396:Slc34a1 APN 13 55402733 missense probably damaging 1.00
IGL01405:Slc34a1 APN 13 55412128 missense probably damaging 1.00
IGL02525:Slc34a1 APN 13 55403238 splice site probably benign
IGL02555:Slc34a1 APN 13 55401168 missense possibly damaging 0.77
IGL02692:Slc34a1 APN 13 55403236 splice site probably benign
IGL03173:Slc34a1 APN 13 55413276 missense probably damaging 0.99
IGL03221:Slc34a1 APN 13 55400778 missense probably benign 0.00
R0190:Slc34a1 UTSW 13 55409101 missense probably benign 0.00
R0196:Slc34a1 UTSW 13 55412265 missense probably damaging 0.99
R0362:Slc34a1 UTSW 13 55402898 splice site probably null
R1055:Slc34a1 UTSW 13 55403033 missense probably benign 0.26
R1243:Slc34a1 UTSW 13 55412131 missense possibly damaging 0.85
R1414:Slc34a1 UTSW 13 55400711 missense probably benign
R1566:Slc34a1 UTSW 13 55412031 critical splice acceptor site probably null
R1732:Slc34a1 UTSW 13 55413420 missense probably benign
R1901:Slc34a1 UTSW 13 55401150 nonsense probably null
R2423:Slc34a1 UTSW 13 55409052 missense possibly damaging 0.63
R2986:Slc34a1 UTSW 13 55403329 missense probably benign 0.00
R3940:Slc34a1 UTSW 13 55413170 missense probably damaging 1.00
R4003:Slc34a1 UTSW 13 55402661 splice site probably benign
R4553:Slc34a1 UTSW 13 55412061 synonymous probably null
R4735:Slc34a1 UTSW 13 55413584 missense probably benign 0.13
R5177:Slc34a1 UTSW 13 55401162 missense probably damaging 0.99
R5345:Slc34a1 UTSW 13 55400518 missense probably benign
R5363:Slc34a1 UTSW 13 55412290 missense probably damaging 1.00
R5668:Slc34a1 UTSW 13 55409085 missense possibly damaging 0.94
R5685:Slc34a1 UTSW 13 55401272 critical splice donor site probably null
R5782:Slc34a1 UTSW 13 55402688 missense possibly damaging 0.92
R5836:Slc34a1 UTSW 13 55413465 missense probably benign 0.05
R6047:Slc34a1 UTSW 13 55412071 missense probably damaging 1.00
R6496:Slc34a1 UTSW 13 55402682 missense probably benign 0.15
R7158:Slc34a1 UTSW 13 55401231 missense probably damaging 0.99
R7384:Slc34a1 UTSW 13 55402934 missense probably benign 0.00
R7694:Slc34a1 UTSW 13 55413408 missense probably benign 0.22
X0022:Slc34a1 UTSW 13 55403015 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCATCATCCAGGTGAGGGTG -3'
(R):5'- GCTAGGAGGGATTACCAATGTC -3'

Sequencing Primer
(F):5'- TGGGACTTGCCACAGGATG -3'
(R):5'- TCCTGGCTGTACTGATGCAGAAC -3'
Posted On2016-08-04