Incidental Mutation 'R0486:G3bp1'
ID 42295
Institutional Source Beutler Lab
Gene Symbol G3bp1
Ensembl Gene ENSMUSG00000018583
Gene Name GTPase activating protein (SH3 domain) binding protein 1
Synonyms GAP SH3 binding protein
MMRRC Submission 038685-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0486 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 55469685-55504838 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55498626 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 383 (F383L)
Ref Sequence ENSEMBL: ENSMUSP00000018727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018727]
AlphaFold P97855
Predicted Effect probably damaging
Transcript: ENSMUST00000018727
AA Change: F383L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018727
Gene: ENSMUSG00000018583
AA Change: F383L

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.8e-35 PFAM
low complexity region 142 167 N/A INTRINSIC
low complexity region 187 206 N/A INTRINSIC
low complexity region 211 225 N/A INTRINSIC
low complexity region 289 305 N/A INTRINSIC
RRM 339 409 1.49e-13 SMART
low complexity region 419 447 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185156
Meta Mutation Damage Score 0.8237 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the DNA-unwinding enzymes which prefers partially unwound 3'-tailed substrates and can also unwind partial RNA/DNA and RNA/RNA duplexes in an ATP-dependent fashion. This enzyme is a member of the heterogeneous nuclear RNA-binding proteins and is also an element of the Ras signal transduction pathway. It binds specifically to the Ras-GTPase-activating protein by associating with its SH3 domain. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display perinatal lethality with severe cell death in the nervous system and decreased cell proliferation. Neonates from heterozygous null female mice display increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco1 T C 4: 40,177,783 L268P probably damaging Het
Adam22 A T 5: 8,330,048 H83Q probably damaging Het
Anln T C 9: 22,352,826 D886G probably benign Het
Arhgef11 T A 3: 87,688,852 probably null Het
Arl8b A T 6: 108,815,326 D116V possibly damaging Het
BC051665 C T 13: 60,784,045 G180D probably damaging Het
Bloc1s2 A G 19: 44,143,150 probably benign Het
Ccdc185 T G 1: 182,747,859 S422R possibly damaging Het
Cd101 T C 3: 101,008,092 K720E possibly damaging Het
Cdh23 C A 10: 60,386,946 A1236S probably damaging Het
Chd1 G A 17: 15,734,342 A491T probably damaging Het
Chdh T C 14: 30,032,858 V275A possibly damaging Het
Cmtm2b A T 8: 104,330,415 I136F probably damaging Het
Cps1 T C 1: 67,165,392 V457A probably damaging Het
Cwf19l1 A G 19: 44,114,690 V362A probably benign Het
Cyp4f17 T C 17: 32,524,823 probably benign Het
Cyp4f18 C A 8: 71,996,017 V263L probably benign Het
Dclre1a A G 19: 56,541,490 probably benign Het
Dpp6 T C 5: 27,661,642 I446T probably benign Het
F11r T C 1: 171,460,588 W61R probably damaging Het
Fam120b C T 17: 15,426,288 probably benign Het
Fastkd2 T C 1: 63,752,340 V669A possibly damaging Het
Foxg1 T C 12: 49,384,531 probably benign Het
Foxo3 A G 10: 42,197,481 Y347H probably damaging Het
Gbp7 C A 3: 142,546,317 probably benign Het
Glipr1 T C 10: 111,996,849 probably benign Het
Gm11555 A G 11: 99,650,160 S8P unknown Het
H6pd G A 4: 149,982,936 probably benign Het
Haus8 C A 8: 71,256,537 G76W probably damaging Het
Haus8 C T 8: 71,256,538 M75I probably benign Het
Kcnj13 C A 1: 87,387,030 V157L probably damaging Het
Kcnt2 T A 1: 140,509,480 C550* probably null Het
Kdm5d A G Y: 927,107 N615S probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Ngef T A 1: 87,479,126 N640I probably damaging Het
Nhlrc3 T C 3: 53,452,437 Y335C probably damaging Het
Nipbl A T 15: 8,338,870 probably benign Het
Nop2 A G 6: 125,140,673 K434R probably null Het
Nr4a3 T C 4: 48,056,525 probably benign Het
Olfr881 A G 9: 37,992,702 N70S possibly damaging Het
Piezo2 A C 18: 63,029,061 I2233R probably damaging Het
Prag1 A T 8: 36,146,633 E1113V probably damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Psmd1 T A 1: 86,094,290 N611K probably damaging Het
Ptpn7 C T 1: 135,137,358 T168I probably damaging Het
Pus1 A T 5: 110,779,730 V53E probably damaging Het
Rgs22 A G 15: 36,092,882 M415T probably damaging Het
Rnf165 T A 18: 77,484,254 Q91L probably damaging Het
Rnf17 C T 14: 56,514,175 T1490M probably benign Het
Rnf20 C A 4: 49,645,907 L332I possibly damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spam1 A T 6: 24,796,395 Q115L probably damaging Het
Syce1l A T 8: 113,654,763 probably null Het
Synj1 T C 16: 90,938,263 probably benign Het
Tas2r126 A T 6: 42,435,291 I253F probably benign Het
Tecpr2 G A 12: 110,896,369 V72I probably benign Het
Tfap2a G T 13: 40,728,694 P45Q probably damaging Het
Trip12 C A 1: 84,761,084 G714* probably null Het
Wdr31 A G 4: 62,453,893 S330P probably damaging Het
Wdr64 T C 1: 175,795,203 probably benign Het
Yes1 T A 5: 32,655,582 Y343* probably null Het
Other mutations in G3bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02231:G3bp1 APN 11 55495447 nonsense probably null
silverheels UTSW 11 55489116 missense possibly damaging 0.95
R0056:G3bp1 UTSW 11 55498041 missense probably benign 0.03
R0113:G3bp1 UTSW 11 55495426 missense probably benign 0.00
R0240:G3bp1 UTSW 11 55492028 missense probably damaging 1.00
R0240:G3bp1 UTSW 11 55492028 missense probably damaging 1.00
R0311:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0312:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0367:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0368:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0454:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0464:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0465:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0466:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0467:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0487:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0533:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0551:G3bp1 UTSW 11 55489143 missense probably benign 0.01
R0689:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0848:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R2109:G3bp1 UTSW 11 55489160 missense probably damaging 0.97
R5129:G3bp1 UTSW 11 55489116 missense possibly damaging 0.95
R5439:G3bp1 UTSW 11 55497987 missense probably damaging 0.96
R5834:G3bp1 UTSW 11 55497940 missense probably benign
R6692:G3bp1 UTSW 11 55493509 missense probably benign 0.00
R6925:G3bp1 UTSW 11 55497960 missense possibly damaging 0.47
R7091:G3bp1 UTSW 11 55496221 missense possibly damaging 0.94
R8348:G3bp1 UTSW 11 55498631 missense possibly damaging 0.81
R9375:G3bp1 UTSW 11 55499613 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGACACAATGCCTTGCCCAC -3'
(R):5'- TCCGAGCTGGAAAATGACACTCAAC -3'

Sequencing Primer
(F):5'- CATCTAAGGAGCTTATCATTGAACTC -3'
(R):5'- acaataggtaactccatgtccag -3'
Posted On 2013-05-23