Incidental Mutation 'R5363:Rasa1'
ID422950
Institutional Source Beutler Lab
Gene Symbol Rasa1
Ensembl Gene ENSMUSG00000021549
Gene NameRAS p21 protein activator 1
Synonymsp120-rasGAP, Gap
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5363 (G1)
Quality Score142
Status Not validated
Chromosome13
Chromosomal Location85214780-85289130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 85288555 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 118 (T118K)
Ref Sequence ENSEMBL: ENSMUSP00000105179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109552]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109552
AA Change: T118K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105179
Gene: ENSMUSG00000021549
AA Change: T118K

DomainStartEndE-ValueType
low complexity region 3 32 N/A INTRINSIC
low complexity region 37 106 N/A INTRINSIC
low complexity region 119 142 N/A INTRINSIC
SH2 170 253 9.44e-29 SMART
SH3 273 331 1.7e-10 SMART
SH2 340 423 7.44e-27 SMART
PH 466 570 5.11e-20 SMART
C2 586 680 6.9e-10 SMART
RasGAP 689 1035 2.77e-156 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223598
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced embryonic growth associated with defects of both yolk sac and embryonic vascular systems resulting in lethality by embryonic day 10.5. Mice homozygous for a knock-in allele exhibit increased sensitivity to induced cell death and colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Rasa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Rasa1 APN 13 85288429 missense probably benign 0.02
IGL01396:Rasa1 APN 13 85258442 missense probably benign 0.10
IGL01670:Rasa1 APN 13 85225490 missense probably damaging 0.97
IGL02095:Rasa1 APN 13 85216155 missense probably benign 0.10
IGL02822:Rasa1 APN 13 85252514 missense probably damaging 0.97
IGL03126:Rasa1 APN 13 85256396 missense possibly damaging 0.94
F5770:Rasa1 UTSW 13 85226945 unclassified probably null
PIT4458001:Rasa1 UTSW 13 85227118 missense possibly damaging 0.91
R1393:Rasa1 UTSW 13 85223522 missense probably damaging 1.00
R1441:Rasa1 UTSW 13 85252421 splice site probably null
R1907:Rasa1 UTSW 13 85226572 nonsense probably null
R4243:Rasa1 UTSW 13 85244195 missense probably damaging 1.00
R4593:Rasa1 UTSW 13 85238221 splice site probably null
R4687:Rasa1 UTSW 13 85226635 missense possibly damaging 0.89
R4689:Rasa1 UTSW 13 85238163 nonsense probably null
R4753:Rasa1 UTSW 13 85288390 splice site probably null
R4758:Rasa1 UTSW 13 85234448 missense probably benign
R4774:Rasa1 UTSW 13 85250502 intron probably benign
R5375:Rasa1 UTSW 13 85288903 intron probably benign
R6134:Rasa1 UTSW 13 85226626 missense probably benign 0.01
R6190:Rasa1 UTSW 13 85233695 missense probably benign 0.02
R6755:Rasa1 UTSW 13 85226598 missense possibly damaging 0.49
R7564:Rasa1 UTSW 13 85228708 missense probably benign 0.09
R7862:Rasa1 UTSW 13 85255411 missense probably damaging 0.99
RF016:Rasa1 UTSW 13 85223488 missense possibly damaging 0.65
X0023:Rasa1 UTSW 13 85233734 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACAGCAGTTTGACTTACTGG -3'
(R):5'- TGTTTCCTCTGCCTGGAGAG -3'

Sequencing Primer
(F):5'- CAGTTTGACTTACTGGTTAGTGGGAG -3'
(R):5'- TTCAACATGATGGCGGCC -3'
Posted On2016-08-04