Mutagenetix > Incidental Mutation

Incidental Mutation 'R5363:Rasa1'

422950

Institutional Source

Beutler Lab

Gene Symbol

Rasa1

Ensembl Gene

ENSMUSG00000021549

Gene Name

RAS p21 protein activator 1

Synonyms

p120-rasGAP, Gap

MMRRC Submission

042941-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5363 (G1)

Quality Score

142

Status

Not validated

Chromosome

Chromosomal Location

85214780-85289130 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 85288555 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 118 (T118K)

Ref Sequence

ENSEMBL: ENSMUSP00000105179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109552]

AlphaFold

E9PYG6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109552
AA Change: T118K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000105179
Gene: ENSMUSG00000021549
AA Change: T118K

Domain	Start	End	E-Value	Type
low complexity region	3	32	N/A	INTRINSIC
low complexity region	37	106	N/A	INTRINSIC
low complexity region	119	142	N/A	INTRINSIC
SH2	170	253	9.44e-29	SMART
SH3	273	331	1.7e-10	SMART
SH2	340	423	7.44e-27	SMART
PH	466	570	5.11e-20	SMART
C2	586	680	6.9e-10	SMART
RasGAP	689	1035	2.77e-156	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000223598

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced embryonic growth associated with defects of both yolk sac and embryonic vascular systems resulting in lethality by embryonic day 10.5. Mice homozygous for a knock-in allele exhibit increased sensitivity to induced cell death and colitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Abca1	A	G	4: 53,132,963	I40T	probably benign	Het
Abca13	T	C	11: 9,277,035	V597A	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc1	A	G	2: 128,650,194		probably null	Het
Ap4e1	G	A	2: 127,037,864		probably null	Het
Apod	T	C	16: 31,311,091	T16A	probably benign	Het
Arrdc5	C	T	17: 56,300,138	V36M	probably damaging	Het
Bcan	A	G	3: 87,995,487	V328A	probably damaging	Het
Bche	A	G	3: 73,700,639	Y485H	probably damaging	Het
Btbd6	A	G	12: 112,978,136	Y356C	probably damaging	Het
Cdh4	A	G	2: 179,886,763	T555A	probably benign	Het
Ciita	C	T	16: 10,512,167	H769Y	probably damaging	Het
Clspn	A	G	4: 126,561,786	D35G	possibly damaging	Het
Cpsf3	T	A	12: 21,308,985	M562K	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cyp2a22	T	A	7: 26,936,433	Q235L	probably damaging	Het
Dicer1	A	G	12: 104,703,151	S1091P	probably damaging	Het
Dync1li1	T	A	9: 114,715,229	I323N	probably damaging	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat4	A	G	3: 38,888,005	N349S	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Hectd4	T	C	5: 121,310,603	M338T	probably benign	Het
Lactb2	A	T	1: 13,630,132	I225N	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mrps30	A	G	13: 118,387,162	S25P	probably benign	Het
Myg1	T	C	15: 102,337,824	V378A	probably benign	Het
Notch4	C	T	17: 34,587,123	T1731I	probably damaging	Het
Ntmt1	A	G	2: 30,820,648	D121G	probably damaging	Het
Olfr1167	A	T	2: 88,149,802	D72E	probably damaging	Het
Olfr763	C	A	10: 129,011,914	P210T	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pclo	A	G	5: 14,669,410	D1187G	unknown	Het
Pkd1	T	A	17: 24,565,073	Y198N	probably benign	Het
Plk4	T	A	3: 40,801,984	N83K	possibly damaging	Het
Prune2	A	T	19: 17,118,266	Q378L	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rin3	G	A	12: 102,325,834	V97M	probably damaging	Het
Rock2	T	C	12: 16,965,654		probably null	Het
Slc34a1	A	G	13: 55,403,268	I289V	probably benign	Het
Slc34a1	T	C	13: 55,412,290	L443P	probably damaging	Het
Slco2a1	A	T	9: 103,070,263	I254F	probably damaging	Het
Spink11	T	C	18: 44,195,686	I32V	probably benign	Het
Spire1	T	C	18: 67,506,555	E296G	probably damaging	Het
Sun1	A	G	5: 139,234,743	N410D	probably damaging	Het
Syt14	T	A	1: 192,930,663	T610S	possibly damaging	Het
Tenm3	T	C	8: 48,287,831	I1206V	possibly damaging	Het
Tet3	A	T	6: 83,376,764		probably null	Het
Thbs1	A	T	2: 118,122,666	Q919L	probably damaging	Het
Trappc10	A	G	10: 78,188,840	F1152L	possibly damaging	Het
Trp63	C	A	16: 25,863,718	N176K	probably damaging	Het
Zbtb17	A	G	4: 141,466,761	E700G	probably benign	Het
Zfp446	G	A	7: 12,978,057	R69H	probably benign	Het
Zfy2	C	T	Y: 2,106,555	C693Y	possibly damaging	Het
Zxdc	A	G	6: 90,382,146	T587A	probably damaging	Het
Zyg11a	A	G	4: 108,189,622	C552R	probably damaging	Het

Other mutations in Rasa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00863:Rasa1	APN	13	85288429	missense	probably benign	0.02
IGL01396:Rasa1	APN	13	85258442	missense	probably benign	0.10
IGL01670:Rasa1	APN	13	85225490	missense	probably damaging	0.97
IGL02095:Rasa1	APN	13	85216155	missense	probably benign	0.10
IGL02822:Rasa1	APN	13	85252514	missense	probably damaging	0.97
IGL03126:Rasa1	APN	13	85256396	missense	possibly damaging	0.94
F5770:Rasa1	UTSW	13	85226945	splice site	probably null
PIT4458001:Rasa1	UTSW	13	85227118	missense	possibly damaging	0.91
R1393:Rasa1	UTSW	13	85223522	missense	probably damaging	1.00
R1441:Rasa1	UTSW	13	85252421	splice site	probably null
R1907:Rasa1	UTSW	13	85226572	nonsense	probably null
R4243:Rasa1	UTSW	13	85244195	missense	probably damaging	1.00
R4593:Rasa1	UTSW	13	85238221	splice site	probably null
R4687:Rasa1	UTSW	13	85226635	missense	possibly damaging	0.89
R4689:Rasa1	UTSW	13	85238163	nonsense	probably null
R4753:Rasa1	UTSW	13	85288390	splice site	probably null
R4758:Rasa1	UTSW	13	85234448	missense	probably benign
R4774:Rasa1	UTSW	13	85250502	intron	probably benign
R5375:Rasa1	UTSW	13	85288903	intron	probably benign
R6134:Rasa1	UTSW	13	85226626	missense	probably benign	0.01
R6190:Rasa1	UTSW	13	85233695	missense	probably benign	0.02
R6755:Rasa1	UTSW	13	85226598	missense	possibly damaging	0.49
R7564:Rasa1	UTSW	13	85228708	missense	probably benign	0.09
R7862:Rasa1	UTSW	13	85255411	missense	probably damaging	0.99
R9138:Rasa1	UTSW	13	85221516	missense	possibly damaging	0.93
R9280:Rasa1	UTSW	13	85288613	missense	unknown
R9328:Rasa1	UTSW	13	85255456	critical splice acceptor site	probably null
R9340:Rasa1	UTSW	13	85221530	missense	probably damaging	0.98
R9648:Rasa1	UTSW	13	85288571	missense	possibly damaging	0.73
RF016:Rasa1	UTSW	13	85223488	missense	possibly damaging	0.65
X0023:Rasa1	UTSW	13	85233734	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAACAGCAGTTTGACTTACTGG -3'
(R):5'- TGTTTCCTCTGCCTGGAGAG -3'

Sequencing Primer
(F):5'- CAGTTTGACTTACTGGTTAGTGGGAG -3'
(R):5'- TTCAACATGATGGCGGCC -3'

Posted On

2016-08-04