Incidental Mutation 'R5363:Mrps30'
ID422951
Institutional Source Beutler Lab
Gene Symbol Mrps30
Ensembl Gene ENSMUSG00000021731
Gene Namemitochondrial ribosomal protein S30
Synonyms2610020A16Rik, Pdcd9
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #R5363 (G1)
Quality Score200
Status Not validated
Chromosome13
Chromosomal Location118378381-118387252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118387162 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 25 (S25P)
Ref Sequence ENSEMBL: ENSMUSP00000022245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022245] [ENSMUST00000181168]
Predicted Effect probably benign
Transcript: ENSMUST00000022245
AA Change: S25P

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022245
Gene: ENSMUSG00000021731
AA Change: S25P

DomainStartEndE-ValueType
Pfam:PDCD9 1 423 1.7e-180 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000181168
AA Change: D120G
SMART Domains Protein: ENSMUSP00000137680
Gene: ENSMUSG00000097411
AA Change: D120G

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
low complexity region 117 125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225170
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that is similar to the chicken pro-apoptotic protein p52. Transcript variants using alternative promoters or polyA sites have been mentioned in the literature but the complete description of these sequences is not available. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Mrps30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Mrps30 APN 13 118380610 missense probably damaging 1.00
R0030:Mrps30 UTSW 13 118382995 missense possibly damaging 0.94
R2439:Mrps30 UTSW 13 118385272 missense probably damaging 1.00
R2764:Mrps30 UTSW 13 118384588 missense probably benign 0.03
R4030:Mrps30 UTSW 13 118380541 missense probably damaging 1.00
R4231:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4232:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4234:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4235:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4236:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4625:Mrps30 UTSW 13 118386714 missense probably benign 0.14
R4935:Mrps30 UTSW 13 118386895 missense possibly damaging 0.82
R5986:Mrps30 UTSW 13 118384565 critical splice donor site probably null
R6566:Mrps30 UTSW 13 118387126 missense probably benign 0.00
R6681:Mrps30 UTSW 13 118380598 missense probably damaging 0.98
R6694:Mrps30 UTSW 13 118386961 missense possibly damaging 0.82
R6699:Mrps30 UTSW 13 118380598 missense probably damaging 0.98
R6700:Mrps30 UTSW 13 118380598 missense probably damaging 0.98
R6788:Mrps30 UTSW 13 118380372 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTGCATCTTGGTGAGAATCCG -3'
(R):5'- GATTGGTTGCAAACTGGATGAC -3'

Sequencing Primer
(F):5'- GCATCTTGGTGAGAATCCGTATCTTC -3'
(R):5'- TTGGTTGCAAACTGGATGACACAAC -3'
Posted On2016-08-04