Incidental Mutation 'R5363:Trp63'
ID 422955
Institutional Source Beutler Lab
Gene Symbol Trp63
Ensembl Gene ENSMUSG00000022510
Gene Name transformation related protein 63
Synonyms p73L, deltaNp63, TAp63, p63, Trp53rp1, KET protein, p51/p63
MMRRC Submission 042941-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.895) question?
Stock # R5363 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 25502513-25710838 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 25682468 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 176 (N176K)
Ref Sequence ENSEMBL: ENSMUSP00000110961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040231] [ENSMUST00000065523] [ENSMUST00000115304] [ENSMUST00000115305] [ENSMUST00000115306] [ENSMUST00000115308] [ENSMUST00000115310]
AlphaFold O88898
Predicted Effect possibly damaging
Transcript: ENSMUST00000040231
AA Change: N176K

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038117
Gene: ENSMUSG00000022510
AA Change: N176K

DomainStartEndE-ValueType
Pfam:P53 69 265 5.4e-110 PFAM
Pfam:P53_tetramer 297 338 2.4e-20 PFAM
low complexity region 343 356 N/A INTRINSIC
low complexity region 358 369 N/A INTRINSIC
SAM 447 513 1.4e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065523
AA Change: N270K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067005
Gene: ENSMUSG00000022510
AA Change: N270K

DomainStartEndE-ValueType
Pfam:P53 163 359 4.9e-110 PFAM
Pfam:P53_tetramer 391 432 2.2e-20 PFAM
low complexity region 437 450 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115304
AA Change: N176K

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110959
Gene: ENSMUSG00000022510
AA Change: N176K

DomainStartEndE-ValueType
Pfam:P53 69 265 1.5e-111 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115305
AA Change: N176K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110960
Gene: ENSMUSG00000022510
AA Change: N176K

DomainStartEndE-ValueType
Pfam:P53 69 265 1.1e-110 PFAM
Pfam:P53_tetramer 297 338 5.5e-21 PFAM
low complexity region 343 358 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115306
AA Change: N176K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110961
Gene: ENSMUSG00000022510
AA Change: N176K

DomainStartEndE-ValueType
Pfam:P53 69 265 2.7e-110 PFAM
Pfam:P53_tetramer 293 334 9.2e-21 PFAM
low complexity region 339 352 N/A INTRINSIC
low complexity region 354 365 N/A INTRINSIC
SAM 443 509 1.4e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115308
AA Change: N270K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110963
Gene: ENSMUSG00000022510
AA Change: N270K

DomainStartEndE-ValueType
Pfam:P53 163 359 3.6e-110 PFAM
Pfam:P53_tetramer 387 428 1.8e-20 PFAM
low complexity region 433 448 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115310
AA Change: N270K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110965
Gene: ENSMUSG00000022510
AA Change: N270K

DomainStartEndE-ValueType
Pfam:P53 163 359 1.3e-112 PFAM
Pfam:P53_tetramer 391 431 7e-21 PFAM
low complexity region 437 450 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
SAM 541 607 1.4e-7 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes tumor protein p63, a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include tumor proteins p53, p63, and p73, which have high sequence similarity to one another. This similarity allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways, including direct and indirect protein interactions. This results in mutual regulation of target gene promoters. Tumor protein p63 -/- mice have several developmental defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Both alternative splicing and the use of alternative promoters result in multiple transcript variants encoding different protein isoforms.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygotes for null mutations lack hair follicles, teeth, eyelids, and all squamous epithelia and derivatives including mammary, lacrymal, salivary, and prostate glands. Mutants have craniofacial anomalies, missing or truncated limbs, and small genitalia, and they die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,132,963 (GRCm39) I40T probably benign Het
Abca13 T C 11: 9,227,035 (GRCm39) V597A possibly damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Anapc1 A G 2: 128,492,114 (GRCm39) probably null Het
Ap4e1 G A 2: 126,879,784 (GRCm39) probably null Het
Apod T C 16: 31,129,909 (GRCm39) T16A probably benign Het
Arrdc5 C T 17: 56,607,138 (GRCm39) V36M probably damaging Het
Bcan A G 3: 87,902,794 (GRCm39) V328A probably damaging Het
Bche A G 3: 73,607,972 (GRCm39) Y485H probably damaging Het
Btbd6 A G 12: 112,941,756 (GRCm39) Y356C probably damaging Het
Cdh4 A G 2: 179,528,556 (GRCm39) T555A probably benign Het
Ciita C T 16: 10,330,031 (GRCm39) H769Y probably damaging Het
Clspn A G 4: 126,455,579 (GRCm39) D35G possibly damaging Het
Cpsf3 T A 12: 21,358,986 (GRCm39) M562K probably benign Het
Cstdc1 G T 2: 148,625,298 (GRCm39) L77F probably damaging Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,759,803 (GRCm39) probably null Het
Cyp2a22 T A 7: 26,635,858 (GRCm39) Q235L probably damaging Het
Dicer1 A G 12: 104,669,410 (GRCm39) S1091P probably damaging Het
Dync1li1 T A 9: 114,544,297 (GRCm39) I323N probably damaging Het
Fat4 A G 3: 38,942,154 (GRCm39) N349S probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Hectd4 T C 5: 121,448,666 (GRCm39) M338T probably benign Het
Insyn2b G A 11: 34,352,788 (GRCm39) E277K probably damaging Het
Lactb2 A T 1: 13,700,356 (GRCm39) I225N probably benign Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Mrps30 A G 13: 118,523,698 (GRCm39) S25P probably benign Het
Myg1 T C 15: 102,246,259 (GRCm39) V378A probably benign Het
Notch4 C T 17: 34,806,097 (GRCm39) T1731I probably damaging Het
Ntmt1 A G 2: 30,710,660 (GRCm39) D121G probably damaging Het
Or10p21 C A 10: 128,847,783 (GRCm39) P210T probably damaging Het
Or5d39 A T 2: 87,980,146 (GRCm39) D72E probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pclo A G 5: 14,719,424 (GRCm39) D1187G unknown Het
Pkd1 T A 17: 24,784,047 (GRCm39) Y198N probably benign Het
Plk4 T A 3: 40,756,419 (GRCm39) N83K possibly damaging Het
Prune2 A T 19: 17,095,630 (GRCm39) Q378L probably damaging Het
R3hdm4 C T 10: 79,748,292 (GRCm39) E162K possibly damaging Het
Rasa1 G T 13: 85,436,674 (GRCm39) T118K possibly damaging Het
Rin3 G A 12: 102,292,093 (GRCm39) V97M probably damaging Het
Rock2 T C 12: 17,015,655 (GRCm39) probably null Het
Slc34a1 A G 13: 55,551,081 (GRCm39) I289V probably benign Het
Slc34a1 T C 13: 55,560,103 (GRCm39) L443P probably damaging Het
Slco2a1 A T 9: 102,947,462 (GRCm39) I254F probably damaging Het
Spink11 T C 18: 44,328,753 (GRCm39) I32V probably benign Het
Spire1 T C 18: 67,639,625 (GRCm39) E296G probably damaging Het
Sun1 A G 5: 139,220,498 (GRCm39) N410D probably damaging Het
Syt14 T A 1: 192,612,971 (GRCm39) T610S possibly damaging Het
Tenm3 T C 8: 48,740,866 (GRCm39) I1206V possibly damaging Het
Tet3 A T 6: 83,353,746 (GRCm39) probably null Het
Thbs1 A T 2: 117,953,147 (GRCm39) Q919L probably damaging Het
Trappc10 A G 10: 78,024,674 (GRCm39) F1152L possibly damaging Het
Zbtb17 A G 4: 141,194,072 (GRCm39) E700G probably benign Het
Zfp446 G A 7: 12,711,984 (GRCm39) R69H probably benign Het
Zfy2 C T Y: 2,106,555 (GRCm39) C693Y possibly damaging Het
Zxdc A G 6: 90,359,128 (GRCm39) T587A probably damaging Het
Zyg11a A G 4: 108,046,819 (GRCm39) C552R probably damaging Het
Other mutations in Trp63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00935:Trp63 APN 16 25,689,826 (GRCm39) missense probably damaging 1.00
IGL01402:Trp63 APN 16 25,639,135 (GRCm39) splice site probably benign
IGL01404:Trp63 APN 16 25,639,135 (GRCm39) splice site probably benign
IGL01874:Trp63 APN 16 25,701,335 (GRCm39) missense possibly damaging 0.88
IGL01887:Trp63 APN 16 25,684,069 (GRCm39) missense probably damaging 1.00
IGL02008:Trp63 APN 16 25,681,211 (GRCm39) missense probably damaging 1.00
IGL02336:Trp63 APN 16 25,639,192 (GRCm39) missense probably damaging 1.00
IGL02470:Trp63 APN 16 25,639,134 (GRCm39) splice site probably benign
IGL02720:Trp63 APN 16 25,682,491 (GRCm39) missense probably damaging 0.96
IGL03230:Trp63 APN 16 25,707,760 (GRCm39) missense probably damaging 1.00
PIT4142001:Trp63 UTSW 16 25,684,013 (GRCm39) missense probably damaging 1.00
R0086:Trp63 UTSW 16 25,689,837 (GRCm39) missense probably damaging 1.00
R0281:Trp63 UTSW 16 25,583,052 (GRCm39) splice site probably benign
R1448:Trp63 UTSW 16 25,707,870 (GRCm39) missense possibly damaging 0.67
R1517:Trp63 UTSW 16 25,708,003 (GRCm39) missense probably damaging 1.00
R1539:Trp63 UTSW 16 25,703,599 (GRCm39) missense probably benign 0.02
R3922:Trp63 UTSW 16 25,707,759 (GRCm39) missense probably damaging 1.00
R3977:Trp63 UTSW 16 25,639,490 (GRCm39) intron probably benign
R3978:Trp63 UTSW 16 25,639,490 (GRCm39) intron probably benign
R3979:Trp63 UTSW 16 25,639,490 (GRCm39) intron probably benign
R4689:Trp63 UTSW 16 25,684,012 (GRCm39) missense possibly damaging 0.90
R4870:Trp63 UTSW 16 25,684,968 (GRCm39) makesense probably null
R5009:Trp63 UTSW 16 25,686,977 (GRCm39) missense probably damaging 0.99
R5033:Trp63 UTSW 16 25,582,056 (GRCm39) missense probably damaging 0.99
R5058:Trp63 UTSW 16 25,701,344 (GRCm39) missense probably damaging 1.00
R5118:Trp63 UTSW 16 25,707,760 (GRCm39) missense unknown
R5354:Trp63 UTSW 16 25,503,105 (GRCm39) splice site probably null
R5668:Trp63 UTSW 16 25,684,935 (GRCm39) missense possibly damaging 0.52
R6004:Trp63 UTSW 16 25,582,146 (GRCm39) critical splice donor site probably null
R6029:Trp63 UTSW 16 25,686,964 (GRCm39) missense probably damaging 1.00
R6170:Trp63 UTSW 16 25,703,603 (GRCm39) missense probably benign 0.28
R6186:Trp63 UTSW 16 25,695,483 (GRCm39) intron probably benign
R6266:Trp63 UTSW 16 25,681,210 (GRCm39) missense probably damaging 0.99
R6466:Trp63 UTSW 16 25,582,108 (GRCm39) missense probably damaging 1.00
R6486:Trp63 UTSW 16 25,684,090 (GRCm39) missense probably damaging 0.99
R6913:Trp63 UTSW 16 25,707,918 (GRCm39) missense probably damaging 1.00
R6980:Trp63 UTSW 16 25,620,843 (GRCm39) missense probably benign
R7097:Trp63 UTSW 16 25,639,227 (GRCm39) missense probably damaging 1.00
R7122:Trp63 UTSW 16 25,639,227 (GRCm39) missense probably damaging 1.00
R7544:Trp63 UTSW 16 25,620,837 (GRCm39) missense probably benign
R7690:Trp63 UTSW 16 25,695,483 (GRCm39) missense unknown
R7743:Trp63 UTSW 16 25,701,375 (GRCm39) missense probably benign 0.05
R7766:Trp63 UTSW 16 25,686,969 (GRCm39) missense probably damaging 0.97
R7792:Trp63 UTSW 16 25,686,974 (GRCm39) missense possibly damaging 0.94
R7816:Trp63 UTSW 16 25,707,990 (GRCm39) missense probably damaging 1.00
R7978:Trp63 UTSW 16 25,639,436 (GRCm39) missense unknown
R8324:Trp63 UTSW 16 25,695,484 (GRCm39) missense unknown
R8857:Trp63 UTSW 16 25,639,226 (GRCm39) missense probably damaging 1.00
R9041:Trp63 UTSW 16 25,582,083 (GRCm39) missense probably benign
R9123:Trp63 UTSW 16 25,639,247 (GRCm39) missense probably damaging 1.00
R9491:Trp63 UTSW 16 25,695,472 (GRCm39) missense unknown
R9642:Trp63 UTSW 16 25,682,508 (GRCm39) missense probably benign 0.35
Z1088:Trp63 UTSW 16 25,582,063 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GACTGGAACTTCATAGCCAAAGGG -3'
(R):5'- ACGGTGATAAATGCTAGATCCCAC -3'

Sequencing Primer
(F):5'- CTTTGCTCAAGGATGTAGGTTTCC -3'
(R):5'- GATCCCACATGTTACCAAATTTGTGC -3'
Posted On 2016-08-04