Mutagenetix > Incidental Mutation

Incidental Mutation 'R5363:Trp63'

422955

Institutional Source

Beutler Lab

Gene Symbol

Trp63

Ensembl Gene

ENSMUSG00000022510

Gene Name

transformation related protein 63

Synonyms

TAp63, deltaNp63, p63, p73L, p51/p63, KET protein, Trp53rp1

MMRRC Submission

042941-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.892) question?

Stock #

R5363 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25683763-25892102 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 25863718 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 176 (N176K)

Ref Sequence

ENSEMBL: ENSMUSP00000110961 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040231] [ENSMUST00000065523] [ENSMUST00000115304] [ENSMUST00000115305] [ENSMUST00000115306] [ENSMUST00000115308] [ENSMUST00000115310]

AlphaFold

O88898

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040231
AA Change: N176K

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000038117
Gene: ENSMUSG00000022510
AA Change: N176K

Domain	Start	End	E-Value	Type
Pfam:P53	69	265	5.4e-110	PFAM
Pfam:P53_tetramer	297	338	2.4e-20	PFAM
low complexity region	343	356	N/A	INTRINSIC
low complexity region	358	369	N/A	INTRINSIC
SAM	447	513	1.4e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000065523
AA Change: N270K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000067005
Gene: ENSMUSG00000022510
AA Change: N270K

Domain	Start	End	E-Value	Type
Pfam:P53	163	359	4.9e-110	PFAM
Pfam:P53_tetramer	391	432	2.2e-20	PFAM
low complexity region	437	450	N/A	INTRINSIC
low complexity region	452	463	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115304
AA Change: N176K

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110959
Gene: ENSMUSG00000022510
AA Change: N176K

Domain	Start	End	E-Value	Type
Pfam:P53	69	265	1.5e-111	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115305
AA Change: N176K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000110960
Gene: ENSMUSG00000022510
AA Change: N176K

Domain	Start	End	E-Value	Type
Pfam:P53	69	265	1.1e-110	PFAM
Pfam:P53_tetramer	297	338	5.5e-21	PFAM
low complexity region	343	358	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115306
AA Change: N176K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000110961
Gene: ENSMUSG00000022510
AA Change: N176K

Domain	Start	End	E-Value	Type
Pfam:P53	69	265	2.7e-110	PFAM
Pfam:P53_tetramer	293	334	9.2e-21	PFAM
low complexity region	339	352	N/A	INTRINSIC
low complexity region	354	365	N/A	INTRINSIC
SAM	443	509	1.4e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115308
AA Change: N270K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000110963
Gene: ENSMUSG00000022510
AA Change: N270K

Domain	Start	End	E-Value	Type
Pfam:P53	163	359	3.6e-110	PFAM
Pfam:P53_tetramer	387	428	1.8e-20	PFAM
low complexity region	433	448	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115310
AA Change: N270K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000110965
Gene: ENSMUSG00000022510
AA Change: N270K

Domain	Start	End	E-Value	Type
Pfam:P53	163	359	1.3e-112	PFAM
Pfam:P53_tetramer	391	431	7e-21	PFAM
low complexity region	437	450	N/A	INTRINSIC
low complexity region	452	463	N/A	INTRINSIC
SAM	541	607	1.4e-7	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes tumor protein p63, a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include tumor proteins p53, p63, and p73, which have high sequence similarity to one another. This similarity allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways, including direct and indirect protein interactions. This results in mutual regulation of target gene promoters. Tumor protein p63 -/- mice have several developmental defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Both alternative splicing and the use of alternative promoters result in multiple transcript variants encoding different protein isoforms.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygotes for null mutations lack hair follicles, teeth, eyelids, and all squamous epithelia and derivatives including mammary, lacrymal, salivary, and prostate glands. Mutants have craniofacial anomalies, missing or truncated limbs, and small genitalia, and they die perinatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Abca1	A	G	4: 53,132,963	I40T	probably benign	Het
Abca13	T	C	11: 9,277,035	V597A	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc1	A	G	2: 128,650,194		probably null	Het
Ap4e1	G	A	2: 127,037,864		probably null	Het
Apod	T	C	16: 31,311,091	T16A	probably benign	Het
Arrdc5	C	T	17: 56,300,138	V36M	probably damaging	Het
Bcan	A	G	3: 87,995,487	V328A	probably damaging	Het
Bche	A	G	3: 73,700,639	Y485H	probably damaging	Het
Btbd6	A	G	12: 112,978,136	Y356C	probably damaging	Het
Cdh4	A	G	2: 179,886,763	T555A	probably benign	Het
Ciita	C	T	16: 10,512,167	H769Y	probably damaging	Het
Clspn	A	G	4: 126,561,786	D35G	possibly damaging	Het
Cpsf3	T	A	12: 21,308,985	M562K	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cyp2a22	T	A	7: 26,936,433	Q235L	probably damaging	Het
Dicer1	A	G	12: 104,703,151	S1091P	probably damaging	Het
Dync1li1	T	A	9: 114,715,229	I323N	probably damaging	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat4	A	G	3: 38,888,005	N349S	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Hectd4	T	C	5: 121,310,603	M338T	probably benign	Het
Lactb2	A	T	1: 13,630,132	I225N	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mrps30	A	G	13: 118,387,162	S25P	probably benign	Het
Myg1	T	C	15: 102,337,824	V378A	probably benign	Het
Notch4	C	T	17: 34,587,123	T1731I	probably damaging	Het
Ntmt1	A	G	2: 30,820,648	D121G	probably damaging	Het
Olfr1167	A	T	2: 88,149,802	D72E	probably damaging	Het
Olfr763	C	A	10: 129,011,914	P210T	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pclo	A	G	5: 14,669,410	D1187G	unknown	Het
Pkd1	T	A	17: 24,565,073	Y198N	probably benign	Het
Plk4	T	A	3: 40,801,984	N83K	possibly damaging	Het
Prune2	A	T	19: 17,118,266	Q378L	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rasa1	G	T	13: 85,288,555	T118K	possibly damaging	Het
Rin3	G	A	12: 102,325,834	V97M	probably damaging	Het
Rock2	T	C	12: 16,965,654		probably null	Het
Slc34a1	A	G	13: 55,403,268	I289V	probably benign	Het
Slc34a1	T	C	13: 55,412,290	L443P	probably damaging	Het
Slco2a1	A	T	9: 103,070,263	I254F	probably damaging	Het
Spink11	T	C	18: 44,195,686	I32V	probably benign	Het
Spire1	T	C	18: 67,506,555	E296G	probably damaging	Het
Sun1	A	G	5: 139,234,743	N410D	probably damaging	Het
Syt14	T	A	1: 192,930,663	T610S	possibly damaging	Het
Tenm3	T	C	8: 48,287,831	I1206V	possibly damaging	Het
Tet3	A	T	6: 83,376,764		probably null	Het
Thbs1	A	T	2: 118,122,666	Q919L	probably damaging	Het
Trappc10	A	G	10: 78,188,840	F1152L	possibly damaging	Het
Zbtb17	A	G	4: 141,466,761	E700G	probably benign	Het
Zfp446	G	A	7: 12,978,057	R69H	probably benign	Het
Zfy2	C	T	Y: 2,106,555	C693Y	possibly damaging	Het
Zxdc	A	G	6: 90,382,146	T587A	probably damaging	Het
Zyg11a	A	G	4: 108,189,622	C552R	probably damaging	Het

Other mutations in Trp63

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00935:Trp63	APN	16	25871076	missense	probably damaging	1.00
IGL01402:Trp63	APN	16	25820385	splice site	probably benign
IGL01404:Trp63	APN	16	25820385	splice site	probably benign
IGL01874:Trp63	APN	16	25882585	missense	possibly damaging	0.88
IGL01887:Trp63	APN	16	25865319	missense	probably damaging	1.00
IGL02008:Trp63	APN	16	25862461	missense	probably damaging	1.00
IGL02336:Trp63	APN	16	25820442	missense	probably damaging	1.00
IGL02470:Trp63	APN	16	25820384	splice site	probably benign
IGL02720:Trp63	APN	16	25863741	missense	probably damaging	0.96
IGL03230:Trp63	APN	16	25889010	missense	probably damaging	1.00
PIT4142001:Trp63	UTSW	16	25865263	missense	probably damaging	1.00
R0086:Trp63	UTSW	16	25871087	missense	probably damaging	1.00
R0281:Trp63	UTSW	16	25764302	splice site	probably benign
R1448:Trp63	UTSW	16	25889120	missense	possibly damaging	0.67
R1517:Trp63	UTSW	16	25889253	missense	probably damaging	1.00
R1539:Trp63	UTSW	16	25884849	missense	probably benign	0.02
R3922:Trp63	UTSW	16	25889009	missense	probably damaging	1.00
R3977:Trp63	UTSW	16	25820740	intron	probably benign
R3978:Trp63	UTSW	16	25820740	intron	probably benign
R3979:Trp63	UTSW	16	25820740	intron	probably benign
R4689:Trp63	UTSW	16	25865262	missense	possibly damaging	0.90
R4870:Trp63	UTSW	16	25866218	makesense	probably null
R5009:Trp63	UTSW	16	25868227	missense	probably damaging	0.99
R5033:Trp63	UTSW	16	25763306	missense	probably damaging	0.99
R5058:Trp63	UTSW	16	25882594	missense	probably damaging	1.00
R5118:Trp63	UTSW	16	25889010	missense	unknown
R5354:Trp63	UTSW	16	25684355	splice site	probably null
R5668:Trp63	UTSW	16	25866185	missense	possibly damaging	0.52
R6004:Trp63	UTSW	16	25763396	critical splice donor site	probably null
R6029:Trp63	UTSW	16	25868214	missense	probably damaging	1.00
R6170:Trp63	UTSW	16	25884853	missense	probably benign	0.28
R6186:Trp63	UTSW	16	25876733	intron	probably benign
R6266:Trp63	UTSW	16	25862460	missense	probably damaging	0.99
R6466:Trp63	UTSW	16	25763358	missense	probably damaging	1.00
R6486:Trp63	UTSW	16	25865340	missense	probably damaging	0.99
R6913:Trp63	UTSW	16	25889168	missense	probably damaging	1.00
R6980:Trp63	UTSW	16	25802093	missense	probably benign
R7097:Trp63	UTSW	16	25820477	missense	probably damaging	1.00
R7122:Trp63	UTSW	16	25820477	missense	probably damaging	1.00
R7544:Trp63	UTSW	16	25802087	missense	probably benign
R7690:Trp63	UTSW	16	25876733	missense	unknown
R7743:Trp63	UTSW	16	25882625	missense	probably benign	0.05
R7766:Trp63	UTSW	16	25868219	missense	probably damaging	0.97
R7792:Trp63	UTSW	16	25868224	missense	possibly damaging	0.94
R7816:Trp63	UTSW	16	25889240	missense	probably damaging	1.00
R7978:Trp63	UTSW	16	25820686	missense	unknown
R8324:Trp63	UTSW	16	25876734	missense	unknown
R8857:Trp63	UTSW	16	25820476	missense	probably damaging	1.00
R9041:Trp63	UTSW	16	25763333	missense	probably benign
R9123:Trp63	UTSW	16	25820497	missense	probably damaging	1.00
R9491:Trp63	UTSW	16	25876722	missense	unknown
R9642:Trp63	UTSW	16	25863758	missense	probably benign	0.35
Z1088:Trp63	UTSW	16	25763313	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GACTGGAACTTCATAGCCAAAGGG -3'
(R):5'- ACGGTGATAAATGCTAGATCCCAC -3'

Sequencing Primer
(F):5'- CTTTGCTCAAGGATGTAGGTTTCC -3'
(R):5'- GATCCCACATGTTACCAAATTTGTGC -3'

Posted On

2016-08-04