Incidental Mutation 'R5363:Apod'
ID 422956
Institutional Source Beutler Lab
Gene Symbol Apod
Ensembl Gene ENSMUSG00000022548
Gene Name apolipoprotein D
Synonyms
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock # R5363 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 31296192-31314808 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 31311091 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 16 (T16A)
Ref Sequence ENSEMBL: ENSMUSP00000119827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115230] [ENSMUST00000130560]
AlphaFold P51910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000023207
Predicted Effect probably benign
Transcript: ENSMUST00000115230
AA Change: T16A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110885
Gene: ENSMUSG00000022548
AA Change: T16A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Lipocalin_2 37 182 3.8e-29 PFAM
Pfam:Lipocalin 43 184 2.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130560
AA Change: T16A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119827
Gene: ENSMUSG00000022548
AA Change: T16A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Lipocalin_2 37 182 3.8e-29 PFAM
Pfam:Lipocalin 43 184 2.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145837
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a component of high-density lipoprotein (HDL), but is unique in that it shares greater structural similarity to lipocalin than to other members of the apolipoprotein family, and has a wider tissue expression pattern. The encoded protein is involved in lipid metabolism, and ablation of this gene results in defects in triglyceride metabolism. Elevated levels of this gene product have been observed in multiple tissues of Niemann-Pick disease mouse models, as well as in some tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for one null allele display increased sensitivity to reactive oxygen species, impaired motor and spatial learning, and decreased vertical and horizontal activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Apod
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4195:Apod UTSW 16 31297574 missense probably benign 0.39
R4619:Apod UTSW 16 31297393 missense probably benign 0.38
R4620:Apod UTSW 16 31297393 missense probably benign 0.38
R4757:Apod UTSW 16 31303462 missense probably damaging 1.00
R5290:Apod UTSW 16 31311066 missense probably damaging 0.96
R5543:Apod UTSW 16 31303533 critical splice acceptor site probably null
R7054:Apod UTSW 16 31311132 missense probably benign
Z1177:Apod UTSW 16 31297520 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGAGTGGGAAGAGATTTGC -3'
(R):5'- AGAGGTATCAAGGCTCTGAGGC -3'

Sequencing Primer
(F):5'- GAGATTTGCTTTGGAGATTCAAAAAG -3'
(R):5'- ATGGCCTTACAGCTGCTG -3'
Posted On 2016-08-04