Incidental Mutation 'R5363:Notch4'
ID 422958
Institutional Source Beutler Lab
Gene Symbol Notch4
Ensembl Gene ENSMUSG00000015468
Gene Name notch 4
Synonyms Int3, N4, Int-3
MMRRC Submission 042941-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5363 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 34564268-34588503 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34587123 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1731 (T1731I)
Ref Sequence ENSEMBL: ENSMUSP00000015612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015612] [ENSMUST00000038244] [ENSMUST00000150924] [ENSMUST00000173328] [ENSMUST00000173389] [ENSMUST00000173772]
AlphaFold P31695
Predicted Effect probably damaging
Transcript: ENSMUST00000015612
AA Change: T1731I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015612
Gene: ENSMUSG00000015468
AA Change: T1731I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 24 60 3.2e-4 SMART
EGF 64 112 1.07e-5 SMART
EGF 118 152 5.49e-3 SMART
EGF 156 189 9.33e-6 SMART
EGF_CA 191 229 1.42e-10 SMART
EGF 234 271 1.11e-3 SMART
EGF 276 309 1.84e-4 SMART
EGF_CA 311 350 2.52e-11 SMART
EGF_CA 352 388 1.85e-9 SMART
EGF 392 427 1.58e-3 SMART
EGF_CA 429 470 2.46e-14 SMART
EGF_CA 472 508 5.03e-11 SMART
EGF_CA 510 546 6.74e-12 SMART
EGF_CA 548 584 2.98e-13 SMART
EGF_CA 586 622 7.63e-11 SMART
EGF_like 645 686 2.86e1 SMART
EGF 691 724 3.48e-5 SMART
EGF 729 762 3.62e-3 SMART
EGF_CA 764 800 1.48e-8 SMART
EGF 806 839 1.74e-5 SMART
EGF 844 877 2.3e-5 SMART
EGF 881 924 3.59e-7 SMART
EGF_CA 926 962 7.29e-8 SMART
EGF_CA 965 1000 4.42e-7 SMART
EGF_CA 1002 1040 4.56e-9 SMART
EGF 1045 1081 6.16e-6 SMART
EGF 1086 1122 8.65e-1 SMART
EGF 1129 1167 1.45e-2 SMART
NL 1159 1200 6.79e-13 SMART
NL 1203 1242 2.01e-15 SMART
NL 1243 1281 1.85e-14 SMART
NOD 1287 1341 4.37e-8 SMART
NODP 1373 1437 2.12e-6 SMART
transmembrane domain 1441 1463 N/A INTRINSIC
low complexity region 1525 1539 N/A INTRINSIC
ANK 1578 1623 2.5e3 SMART
ANK 1628 1657 1.12e-3 SMART
ANK 1661 1691 5.01e-1 SMART
ANK 1695 1724 1.65e-1 SMART
ANK 1728 1757 4.56e-4 SMART
ANK 1761 1790 2.88e-1 SMART
low complexity region 1889 1906 N/A INTRINSIC
low complexity region 1925 1937 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038244
SMART Domains Protein: ENSMUSP00000045911
Gene: ENSMUSG00000034786

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
GoLoco 61 83 2.02e-6 SMART
low complexity region 86 100 N/A INTRINSIC
GoLoco 103 125 2.42e-4 SMART
GoLoco 131 154 4.05e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150441
Predicted Effect probably benign
Transcript: ENSMUST00000150924
Predicted Effect probably benign
Transcript: ENSMUST00000151654
Predicted Effect probably benign
Transcript: ENSMUST00000151867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156724
Predicted Effect probably benign
Transcript: ENSMUST00000173328
SMART Domains Protein: ENSMUSP00000133766
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
Pfam:PBC 1 161 5e-84 PFAM
HOX 162 227 1.9e-18 SMART
low complexity region 245 271 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174707
Predicted Effect probably benign
Transcript: ENSMUST00000173389
SMART Domains Protein: ENSMUSP00000133574
Gene: ENSMUSG00000015468

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 28 64 3.2e-4 SMART
EGF 68 116 1.07e-5 SMART
EGF 122 156 5.49e-3 SMART
EGF 160 193 9.33e-6 SMART
EGF_CA 195 233 1.42e-10 SMART
EGF 238 275 1.11e-3 SMART
EGF 280 313 1.84e-4 SMART
EGF_CA 315 354 2.52e-11 SMART
EGF_CA 356 392 1.85e-9 SMART
EGF 396 431 1.58e-3 SMART
EGF_CA 433 474 2.46e-14 SMART
EGF_CA 476 512 5.03e-11 SMART
EGF_CA 514 550 6.74e-12 SMART
EGF_CA 552 588 2.98e-13 SMART
EGF_CA 590 626 7.63e-11 SMART
EGF_like 649 690 2.86e1 SMART
EGF 695 728 3.48e-5 SMART
EGF 733 766 3.62e-3 SMART
EGF_CA 768 804 1.48e-8 SMART
EGF 810 843 1.74e-5 SMART
EGF 848 881 2.3e-5 SMART
EGF 885 928 3.59e-7 SMART
EGF_like 930 955 7.02e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173772
SMART Domains Protein: ENSMUSP00000134130
Gene: ENSMUSG00000034786

DomainStartEndE-ValueType
GoLoco 27 50 4.05e-6 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor may play a role in vascular, renal and hepatic development. Mutations in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but exhibit a slight delay in postnatal retinal angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 (GRCm38) L77F probably damaging Het
Abca1 A G 4: 53,132,963 (GRCm38) I40T probably benign Het
Abca13 T C 11: 9,277,035 (GRCm38) V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 (GRCm38) L458M probably damaging Het
Anapc1 A G 2: 128,650,194 (GRCm38) probably null Het
Ap4e1 G A 2: 127,037,864 (GRCm38) probably null Het
Apod T C 16: 31,311,091 (GRCm38) T16A probably benign Het
Arrdc5 C T 17: 56,300,138 (GRCm38) V36M probably damaging Het
Bcan A G 3: 87,995,487 (GRCm38) V328A probably damaging Het
Bche A G 3: 73,700,639 (GRCm38) Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 (GRCm38) Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 (GRCm38) T555A probably benign Het
Ciita C T 16: 10,512,167 (GRCm38) H769Y probably damaging Het
Clspn A G 4: 126,561,786 (GRCm38) D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 (GRCm38) M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 (GRCm38) probably null Het
Cyp2a22 T A 7: 26,936,433 (GRCm38) Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 (GRCm38) S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 (GRCm38) I323N probably damaging Het
Fam196b G A 11: 34,402,788 (GRCm38) E277K probably damaging Het
Fat4 A G 3: 38,888,005 (GRCm38) N349S probably damaging Het
Fkbpl G A 17: 34,645,329 (GRCm38) A24T probably benign Het
Hectd4 T C 5: 121,310,603 (GRCm38) M338T probably benign Het
Lactb2 A T 1: 13,630,132 (GRCm38) I225N probably benign Het
Ltbr G A 6: 125,312,794 (GRCm38) R146W probably damaging Het
Mrps30 A G 13: 118,387,162 (GRCm38) S25P probably benign Het
Myg1 T C 15: 102,337,824 (GRCm38) V378A probably benign Het
Ntmt1 A G 2: 30,820,648 (GRCm38) D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 (GRCm38) D72E probably damaging Het
Olfr763 C A 10: 129,011,914 (GRCm38) P210T probably damaging Het
Otx1 C A 11: 21,997,037 (GRCm38) A91S probably damaging Het
Pclo A G 5: 14,669,410 (GRCm38) D1187G unknown Het
Pkd1 T A 17: 24,565,073 (GRCm38) Y198N probably benign Het
Plk4 T A 3: 40,801,984 (GRCm38) N83K possibly damaging Het
Prune2 A T 19: 17,118,266 (GRCm38) Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 (GRCm38) E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 (GRCm38) T118K possibly damaging Het
Rin3 G A 12: 102,325,834 (GRCm38) V97M probably damaging Het
Rock2 T C 12: 16,965,654 (GRCm38) probably null Het
Slc34a1 A G 13: 55,403,268 (GRCm38) I289V probably benign Het
Slc34a1 T C 13: 55,412,290 (GRCm38) L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 (GRCm38) I254F probably damaging Het
Spink11 T C 18: 44,195,686 (GRCm38) I32V probably benign Het
Spire1 T C 18: 67,506,555 (GRCm38) E296G probably damaging Het
Sun1 A G 5: 139,234,743 (GRCm38) N410D probably damaging Het
Syt14 T A 1: 192,930,663 (GRCm38) T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 (GRCm38) I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 (GRCm38) probably null Het
Thbs1 A T 2: 118,122,666 (GRCm38) Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 (GRCm38) F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 (GRCm38) N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 (GRCm38) E700G probably benign Het
Zfp446 G A 7: 12,978,057 (GRCm38) R69H probably benign Het
Zfy2 C T Y: 2,106,555 (GRCm38) C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 (GRCm38) T587A probably damaging Het
Zyg11a A G 4: 108,189,622 (GRCm38) C552R probably damaging Het
Other mutations in Notch4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Notch4 APN 17 34,575,561 (GRCm38) critical splice donor site probably null
IGL01022:Notch4 APN 17 34,565,697 (GRCm38) missense probably damaging 1.00
IGL01356:Notch4 APN 17 34,581,026 (GRCm38) missense possibly damaging 0.67
IGL01634:Notch4 APN 17 34,572,588 (GRCm38) missense probably damaging 1.00
IGL02150:Notch4 APN 17 34,584,613 (GRCm38) missense probably damaging 1.00
IGL02248:Notch4 APN 17 34,587,198 (GRCm38) missense probably damaging 1.00
IGL02271:Notch4 APN 17 34,568,471 (GRCm38) missense probably damaging 1.00
IGL02299:Notch4 APN 17 34,578,004 (GRCm38) missense probably damaging 1.00
IGL02561:Notch4 APN 17 34,568,160 (GRCm38) splice site probably benign
IGL02604:Notch4 APN 17 34,565,388 (GRCm38) splice site probably null
IGL03323:Notch4 APN 17 34,582,471 (GRCm38) missense probably damaging 1.00
IGL03366:Notch4 APN 17 34,572,568 (GRCm38) missense probably damaging 1.00
IGL03408:Notch4 APN 17 34,565,568 (GRCm38) missense probably benign 0.03
K3955:Notch4 UTSW 17 34,568,462 (GRCm38) missense probably damaging 1.00
R0123:Notch4 UTSW 17 34,565,363 (GRCm38) missense possibly damaging 0.85
R0366:Notch4 UTSW 17 34,581,499 (GRCm38) splice site probably benign
R0446:Notch4 UTSW 17 34,565,363 (GRCm38) missense possibly damaging 0.85
R0490:Notch4 UTSW 17 34,582,890 (GRCm38) missense probably damaging 1.00
R0504:Notch4 UTSW 17 34,575,091 (GRCm38) missense probably damaging 1.00
R0545:Notch4 UTSW 17 34,583,433 (GRCm38) missense probably damaging 1.00
R0702:Notch4 UTSW 17 34,575,203 (GRCm38) missense probably damaging 1.00
R0763:Notch4 UTSW 17 34,565,332 (GRCm38) nonsense probably null
R0854:Notch4 UTSW 17 34,568,572 (GRCm38) missense probably damaging 1.00
R1082:Notch4 UTSW 17 34,587,390 (GRCm38) missense probably damaging 1.00
R1196:Notch4 UTSW 17 34,568,863 (GRCm38) missense probably damaging 1.00
R1316:Notch4 UTSW 17 34,567,470 (GRCm38) missense probably damaging 1.00
R1493:Notch4 UTSW 17 34,567,682 (GRCm38) nonsense probably null
R1527:Notch4 UTSW 17 34,565,744 (GRCm38) missense probably damaging 1.00
R1548:Notch4 UTSW 17 34,568,422 (GRCm38) missense probably damaging 1.00
R1718:Notch4 UTSW 17 34,576,763 (GRCm38) splice site probably benign
R1855:Notch4 UTSW 17 34,580,962 (GRCm38) missense probably benign 0.05
R1988:Notch4 UTSW 17 34,587,588 (GRCm38) missense possibly damaging 0.59
R2022:Notch4 UTSW 17 34,587,528 (GRCm38) missense probably damaging 1.00
R2023:Notch4 UTSW 17 34,587,528 (GRCm38) missense probably damaging 1.00
R2078:Notch4 UTSW 17 34,568,715 (GRCm38) critical splice acceptor site probably null
R2369:Notch4 UTSW 17 34,585,950 (GRCm38) missense probably benign 0.15
R3846:Notch4 UTSW 17 34,578,097 (GRCm38) missense probably damaging 1.00
R3874:Notch4 UTSW 17 34,578,069 (GRCm38) nonsense probably null
R4087:Notch4 UTSW 17 34,584,435 (GRCm38) missense probably damaging 1.00
R4456:Notch4 UTSW 17 34,583,833 (GRCm38) missense probably damaging 0.99
R4628:Notch4 UTSW 17 34,570,185 (GRCm38) missense probably damaging 1.00
R4728:Notch4 UTSW 17 34,570,205 (GRCm38) missense probably benign 0.00
R4778:Notch4 UTSW 17 34,582,511 (GRCm38) missense possibly damaging 0.95
R4818:Notch4 UTSW 17 34,578,716 (GRCm38) splice site probably benign
R4828:Notch4 UTSW 17 34,570,060 (GRCm38) missense probably damaging 1.00
R4830:Notch4 UTSW 17 34,570,118 (GRCm38) missense probably damaging 1.00
R4859:Notch4 UTSW 17 34,587,180 (GRCm38) missense probably damaging 1.00
R4871:Notch4 UTSW 17 34,577,562 (GRCm38) missense possibly damaging 0.63
R5090:Notch4 UTSW 17 34,580,920 (GRCm38) missense probably damaging 0.99
R5290:Notch4 UTSW 17 34,565,289 (GRCm38) missense probably benign 0.01
R5860:Notch4 UTSW 17 34,582,418 (GRCm38) missense probably damaging 1.00
R6352:Notch4 UTSW 17 34,567,461 (GRCm38) missense probably damaging 1.00
R6385:Notch4 UTSW 17 34,573,814 (GRCm38) missense probably null 0.16
R6422:Notch4 UTSW 17 34,584,559 (GRCm38) missense probably benign
R6645:Notch4 UTSW 17 34,587,816 (GRCm38) missense probably benign 0.00
R6836:Notch4 UTSW 17 34,586,100 (GRCm38) missense probably damaging 0.96
R6943:Notch4 UTSW 17 34,583,603 (GRCm38) missense probably benign
R6991:Notch4 UTSW 17 34,584,800 (GRCm38) nonsense probably null
R7078:Notch4 UTSW 17 34,582,546 (GRCm38) missense possibly damaging 0.94
R7168:Notch4 UTSW 17 34,572,693 (GRCm38) missense probably benign 0.05
R7182:Notch4 UTSW 17 34,583,499 (GRCm38) missense probably damaging 1.00
R7240:Notch4 UTSW 17 34,576,471 (GRCm38) missense probably benign 0.00
R7247:Notch4 UTSW 17 34,572,517 (GRCm38) missense probably damaging 1.00
R7556:Notch4 UTSW 17 34,575,470 (GRCm38) missense probably damaging 1.00
R7571:Notch4 UTSW 17 34,583,574 (GRCm38) missense probably damaging 0.99
R7697:Notch4 UTSW 17 34,570,185 (GRCm38) missense probably damaging 1.00
R7763:Notch4 UTSW 17 34,582,418 (GRCm38) missense probably damaging 1.00
R7994:Notch4 UTSW 17 34,578,090 (GRCm38) missense possibly damaging 0.82
R8139:Notch4 UTSW 17 34,584,800 (GRCm38) nonsense probably null
R8171:Notch4 UTSW 17 34,582,509 (GRCm38) nonsense probably null
R8375:Notch4 UTSW 17 34,568,254 (GRCm38) missense possibly damaging 0.90
R8448:Notch4 UTSW 17 34,586,789 (GRCm38) splice site probably null
R8543:Notch4 UTSW 17 34,568,420 (GRCm38) missense probably damaging 1.00
R8776:Notch4 UTSW 17 34,587,605 (GRCm38) missense probably damaging 1.00
R8776-TAIL:Notch4 UTSW 17 34,587,605 (GRCm38) missense probably damaging 1.00
R8847:Notch4 UTSW 17 34,584,988 (GRCm38) splice site probably benign
R8885:Notch4 UTSW 17 34,584,496 (GRCm38) missense possibly damaging 0.94
R9126:Notch4 UTSW 17 34,581,106 (GRCm38) missense probably benign 0.00
R9184:Notch4 UTSW 17 34,587,390 (GRCm38) missense probably damaging 1.00
R9425:Notch4 UTSW 17 34,576,827 (GRCm38) missense probably benign 0.42
R9434:Notch4 UTSW 17 34,582,699 (GRCm38) missense probably damaging 1.00
R9462:Notch4 UTSW 17 34,587,693 (GRCm38) missense probably benign 0.00
R9664:Notch4 UTSW 17 34,565,627 (GRCm38) missense probably benign 0.07
R9772:Notch4 UTSW 17 34,573,909 (GRCm38) critical splice donor site probably null
X0054:Notch4 UTSW 17 34,584,495 (GRCm38) missense probably damaging 1.00
X0067:Notch4 UTSW 17 34,586,084 (GRCm38) nonsense probably null
Z1088:Notch4 UTSW 17 34,587,915 (GRCm38) missense probably damaging 1.00
Z1177:Notch4 UTSW 17 34,587,909 (GRCm38) missense probably benign 0.04
Z1177:Notch4 UTSW 17 34,587,908 (GRCm38) missense probably damaging 0.97
Z1177:Notch4 UTSW 17 34,575,148 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACTTGCAGCCGACTGTC -3'
(R):5'- AGGAAAAGCGGCGTCTGTTC -3'

Sequencing Primer
(F):5'- ACTGTCGGTTGCCAGGG -3'
(R):5'- CGTCTGTTCCTGCGGAG -3'
Posted On 2016-08-04