Mutagenetix > Incidental Mutations

Incidental Mutation 'R5363:Notch4'

422958

Institutional Source

Beutler Lab

Gene Symbol

Notch4

Ensembl Gene

ENSMUSG00000015468

Gene Name

notch 4

Synonyms

Int3, N4, Int-3

MMRRC Submission

042941-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5363 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34564268-34588503 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 34587123 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1731 (T1731I)

Ref Sequence

ENSEMBL: ENSMUSP00000015612 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015612] [ENSMUST00000038244] [ENSMUST00000150924] [ENSMUST00000173328] [ENSMUST00000173389] [ENSMUST00000173772]

AlphaFold

P31695

Predicted Effect

probably damaging
Transcript: ENSMUST00000015612
AA Change: T1731I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000015612
Gene: ENSMUSG00000015468
AA Change: T1731I

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	24	60	3.2e-4	SMART
EGF	64	112	1.07e-5	SMART
EGF	118	152	5.49e-3	SMART
EGF	156	189	9.33e-6	SMART
EGF_CA	191	229	1.42e-10	SMART
EGF	234	271	1.11e-3	SMART
EGF	276	309	1.84e-4	SMART
EGF_CA	311	350	2.52e-11	SMART
EGF_CA	352	388	1.85e-9	SMART
EGF	392	427	1.58e-3	SMART
EGF_CA	429	470	2.46e-14	SMART
EGF_CA	472	508	5.03e-11	SMART
EGF_CA	510	546	6.74e-12	SMART
EGF_CA	548	584	2.98e-13	SMART
EGF_CA	586	622	7.63e-11	SMART
EGF_like	645	686	2.86e1	SMART
EGF	691	724	3.48e-5	SMART
EGF	729	762	3.62e-3	SMART
EGF_CA	764	800	1.48e-8	SMART
EGF	806	839	1.74e-5	SMART
EGF	844	877	2.3e-5	SMART
EGF	881	924	3.59e-7	SMART
EGF_CA	926	962	7.29e-8	SMART
EGF_CA	965	1000	4.42e-7	SMART
EGF_CA	1002	1040	4.56e-9	SMART
EGF	1045	1081	6.16e-6	SMART
EGF	1086	1122	8.65e-1	SMART
EGF	1129	1167	1.45e-2	SMART
NL	1159	1200	6.79e-13	SMART
NL	1203	1242	2.01e-15	SMART
NL	1243	1281	1.85e-14	SMART
NOD	1287	1341	4.37e-8	SMART
NODP	1373	1437	2.12e-6	SMART
transmembrane domain	1441	1463	N/A	INTRINSIC
low complexity region	1525	1539	N/A	INTRINSIC
ANK	1578	1623	2.5e3	SMART
ANK	1628	1657	1.12e-3	SMART
ANK	1661	1691	5.01e-1	SMART
ANK	1695	1724	1.65e-1	SMART
ANK	1728	1757	4.56e-4	SMART
ANK	1761	1790	2.88e-1	SMART
low complexity region	1889	1906	N/A	INTRINSIC
low complexity region	1925	1937	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000038244

SMART Domains

Protein: ENSMUSP00000045911
Gene: ENSMUSG00000034786

Domain	Start	End	E-Value	Type
low complexity region	29	42	N/A	INTRINSIC
GoLoco	61	83	2.02e-6	SMART
low complexity region	86	100	N/A	INTRINSIC
GoLoco	103	125	2.42e-4	SMART
GoLoco	131	154	4.05e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126702

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128314

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141768

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150441

Predicted Effect

probably benign
Transcript: ENSMUST00000150924

Predicted Effect

probably benign
Transcript: ENSMUST00000151654

Predicted Effect

probably benign
Transcript: ENSMUST00000151867

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156724

Predicted Effect

probably benign
Transcript: ENSMUST00000173328

SMART Domains

Protein: ENSMUSP00000133766
Gene: ENSMUSG00000034673

Domain	Start	End	E-Value	Type
Pfam:PBC	1	161	5e-84	PFAM
HOX	162	227	1.9e-18	SMART
low complexity region	245	271	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173389

SMART Domains

Protein: ENSMUSP00000133574
Gene: ENSMUSG00000015468

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	28	64	3.2e-4	SMART
EGF	68	116	1.07e-5	SMART
EGF	122	156	5.49e-3	SMART
EGF	160	193	9.33e-6	SMART
EGF_CA	195	233	1.42e-10	SMART
EGF	238	275	1.11e-3	SMART
EGF	280	313	1.84e-4	SMART
EGF_CA	315	354	2.52e-11	SMART
EGF_CA	356	392	1.85e-9	SMART
EGF	396	431	1.58e-3	SMART
EGF_CA	433	474	2.46e-14	SMART
EGF_CA	476	512	5.03e-11	SMART
EGF_CA	514	550	6.74e-12	SMART
EGF_CA	552	588	2.98e-13	SMART
EGF_CA	590	626	7.63e-11	SMART
EGF_like	649	690	2.86e1	SMART
EGF	695	728	3.48e-5	SMART
EGF	733	766	3.62e-3	SMART
EGF_CA	768	804	1.48e-8	SMART
EGF	810	843	1.74e-5	SMART
EGF	848	881	2.3e-5	SMART
EGF	885	928	3.59e-7	SMART
EGF_like	930	955	7.02e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174707

Predicted Effect

probably benign
Transcript: ENSMUST00000173772

SMART Domains

Protein: ENSMUSP00000134130
Gene: ENSMUSG00000034786

Domain	Start	End	E-Value	Type
GoLoco	27	50	4.05e-6	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor may play a role in vascular, renal and hepatic development. Mutations in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but exhibit a slight delay in postnatal retinal angiogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Abca1	A	G	4: 53,132,963	I40T	probably benign	Het
Abca13	T	C	11: 9,277,035	V597A	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc1	A	G	2: 128,650,194		probably null	Het
Ap4e1	G	A	2: 127,037,864		probably null	Het
Apod	T	C	16: 31,311,091	T16A	probably benign	Het
Arrdc5	C	T	17: 56,300,138	V36M	probably damaging	Het
Bcan	A	G	3: 87,995,487	V328A	probably damaging	Het
Bche	A	G	3: 73,700,639	Y485H	probably damaging	Het
Btbd6	A	G	12: 112,978,136	Y356C	probably damaging	Het
Cdh4	A	G	2: 179,886,763	T555A	probably benign	Het
Ciita	C	T	16: 10,512,167	H769Y	probably damaging	Het
Clspn	A	G	4: 126,561,786	D35G	possibly damaging	Het
Cpsf3	T	A	12: 21,308,985	M562K	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cyp2a22	T	A	7: 26,936,433	Q235L	probably damaging	Het
Dicer1	A	G	12: 104,703,151	S1091P	probably damaging	Het
Dync1li1	T	A	9: 114,715,229	I323N	probably damaging	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat4	A	G	3: 38,888,005	N349S	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Hectd4	T	C	5: 121,310,603	M338T	probably benign	Het
Lactb2	A	T	1: 13,630,132	I225N	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mrps30	A	G	13: 118,387,162	S25P	probably benign	Het
Myg1	T	C	15: 102,337,824	V378A	probably benign	Het
Ntmt1	A	G	2: 30,820,648	D121G	probably damaging	Het
Olfr1167	A	T	2: 88,149,802	D72E	probably damaging	Het
Olfr763	C	A	10: 129,011,914	P210T	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pclo	A	G	5: 14,669,410	D1187G	unknown	Het
Pkd1	T	A	17: 24,565,073	Y198N	probably benign	Het
Plk4	T	A	3: 40,801,984	N83K	possibly damaging	Het
Prune2	A	T	19: 17,118,266	Q378L	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rasa1	G	T	13: 85,288,555	T118K	possibly damaging	Het
Rin3	G	A	12: 102,325,834	V97M	probably damaging	Het
Rock2	T	C	12: 16,965,654		probably null	Het
Slc34a1	A	G	13: 55,403,268	I289V	probably benign	Het
Slc34a1	T	C	13: 55,412,290	L443P	probably damaging	Het
Slco2a1	A	T	9: 103,070,263	I254F	probably damaging	Het
Spink11	T	C	18: 44,195,686	I32V	probably benign	Het
Spire1	T	C	18: 67,506,555	E296G	probably damaging	Het
Sun1	A	G	5: 139,234,743	N410D	probably damaging	Het
Syt14	T	A	1: 192,930,663	T610S	possibly damaging	Het
Tenm3	T	C	8: 48,287,831	I1206V	possibly damaging	Het
Tet3	A	T	6: 83,376,764		probably null	Het
Thbs1	A	T	2: 118,122,666	Q919L	probably damaging	Het
Trappc10	A	G	10: 78,188,840	F1152L	possibly damaging	Het
Trp63	C	A	16: 25,863,718	N176K	probably damaging	Het
Zbtb17	A	G	4: 141,466,761	E700G	probably benign	Het
Zfp446	G	A	7: 12,978,057	R69H	probably benign	Het
Zfy2	C	T	Y: 2,106,555	C693Y	possibly damaging	Het
Zxdc	A	G	6: 90,382,146	T587A	probably damaging	Het
Zyg11a	A	G	4: 108,189,622	C552R	probably damaging	Het

Other mutations in Notch4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Notch4	APN	17	34575561	critical splice donor site	probably null
IGL01022:Notch4	APN	17	34565697	missense	probably damaging	1.00
IGL01356:Notch4	APN	17	34581026	missense	possibly damaging	0.67
IGL01634:Notch4	APN	17	34572588	missense	probably damaging	1.00
IGL02150:Notch4	APN	17	34584613	missense	probably damaging	1.00
IGL02248:Notch4	APN	17	34587198	missense	probably damaging	1.00
IGL02271:Notch4	APN	17	34568471	missense	probably damaging	1.00
IGL02299:Notch4	APN	17	34578004	missense	probably damaging	1.00
IGL02561:Notch4	APN	17	34568160	splice site	probably benign
IGL02604:Notch4	APN	17	34565388	splice site	probably null
IGL03323:Notch4	APN	17	34582471	missense	probably damaging	1.00
IGL03366:Notch4	APN	17	34572568	missense	probably damaging	1.00
IGL03408:Notch4	APN	17	34565568	missense	probably benign	0.03
K3955:Notch4	UTSW	17	34568462	missense	probably damaging	1.00
R0123:Notch4	UTSW	17	34565363	missense	possibly damaging	0.85
R0366:Notch4	UTSW	17	34581499	splice site	probably benign
R0446:Notch4	UTSW	17	34565363	missense	possibly damaging	0.85
R0490:Notch4	UTSW	17	34582890	missense	probably damaging	1.00
R0504:Notch4	UTSW	17	34575091	missense	probably damaging	1.00
R0545:Notch4	UTSW	17	34583433	missense	probably damaging	1.00
R0702:Notch4	UTSW	17	34575203	missense	probably damaging	1.00
R0763:Notch4	UTSW	17	34565332	nonsense	probably null
R0854:Notch4	UTSW	17	34568572	missense	probably damaging	1.00
R1082:Notch4	UTSW	17	34587390	missense	probably damaging	1.00
R1196:Notch4	UTSW	17	34568863	missense	probably damaging	1.00
R1316:Notch4	UTSW	17	34567470	missense	probably damaging	1.00
R1493:Notch4	UTSW	17	34567682	nonsense	probably null
R1527:Notch4	UTSW	17	34565744	missense	probably damaging	1.00
R1548:Notch4	UTSW	17	34568422	missense	probably damaging	1.00
R1718:Notch4	UTSW	17	34576763	splice site	probably benign
R1855:Notch4	UTSW	17	34580962	missense	probably benign	0.05
R1988:Notch4	UTSW	17	34587588	missense	possibly damaging	0.59
R2022:Notch4	UTSW	17	34587528	missense	probably damaging	1.00
R2023:Notch4	UTSW	17	34587528	missense	probably damaging	1.00
R2078:Notch4	UTSW	17	34568715	critical splice acceptor site	probably null
R2369:Notch4	UTSW	17	34585950	missense	probably benign	0.15
R3846:Notch4	UTSW	17	34578097	missense	probably damaging	1.00
R3874:Notch4	UTSW	17	34578069	nonsense	probably null
R4087:Notch4	UTSW	17	34584435	missense	probably damaging	1.00
R4456:Notch4	UTSW	17	34583833	missense	probably damaging	0.99
R4628:Notch4	UTSW	17	34570185	missense	probably damaging	1.00
R4728:Notch4	UTSW	17	34570205	missense	probably benign	0.00
R4778:Notch4	UTSW	17	34582511	missense	possibly damaging	0.95
R4818:Notch4	UTSW	17	34578716	splice site	probably benign
R4828:Notch4	UTSW	17	34570060	missense	probably damaging	1.00
R4830:Notch4	UTSW	17	34570118	missense	probably damaging	1.00
R4859:Notch4	UTSW	17	34587180	missense	probably damaging	1.00
R4871:Notch4	UTSW	17	34577562	missense	possibly damaging	0.63
R5090:Notch4	UTSW	17	34580920	missense	probably damaging	0.99
R5290:Notch4	UTSW	17	34565289	missense	probably benign	0.01
R5860:Notch4	UTSW	17	34582418	missense	probably damaging	1.00
R6352:Notch4	UTSW	17	34567461	missense	probably damaging	1.00
R6385:Notch4	UTSW	17	34573814	missense	probably null	0.16
R6422:Notch4	UTSW	17	34584559	missense	probably benign
R6645:Notch4	UTSW	17	34587816	missense	probably benign	0.00
R6836:Notch4	UTSW	17	34586100	missense	probably damaging	0.96
R6943:Notch4	UTSW	17	34583603	missense	probably benign
R6991:Notch4	UTSW	17	34584800	nonsense	probably null
R7078:Notch4	UTSW	17	34582546	missense	possibly damaging	0.94
R7168:Notch4	UTSW	17	34572693	missense	probably benign	0.05
R7182:Notch4	UTSW	17	34583499	missense	probably damaging	1.00
R7240:Notch4	UTSW	17	34576471	missense	probably benign	0.00
R7247:Notch4	UTSW	17	34572517	missense	probably damaging	1.00
R7556:Notch4	UTSW	17	34575470	missense	probably damaging	1.00
R7571:Notch4	UTSW	17	34583574	missense	probably damaging	0.99
R7697:Notch4	UTSW	17	34570185	missense	probably damaging	1.00
R7763:Notch4	UTSW	17	34582418	missense	probably damaging	1.00
R7994:Notch4	UTSW	17	34578090	missense	possibly damaging	0.82
R8139:Notch4	UTSW	17	34584800	nonsense	probably null
R8171:Notch4	UTSW	17	34582509	nonsense	probably null
R8375:Notch4	UTSW	17	34568254	missense	possibly damaging	0.90
R8448:Notch4	UTSW	17	34586789	splice site	probably null
R8543:Notch4	UTSW	17	34568420	missense	probably damaging	1.00
R8776:Notch4	UTSW	17	34587605	missense	probably damaging	1.00
R8776-TAIL:Notch4	UTSW	17	34587605	missense	probably damaging	1.00
R8847:Notch4	UTSW	17	34584988	splice site	probably benign
R8885:Notch4	UTSW	17	34584496	missense	possibly damaging	0.94
R9126:Notch4	UTSW	17	34581106	missense	probably benign	0.00
R9184:Notch4	UTSW	17	34587390	missense	probably damaging	1.00
R9425:Notch4	UTSW	17	34576827	missense	probably benign	0.42
R9434:Notch4	UTSW	17	34582699	missense	probably damaging	1.00
X0054:Notch4	UTSW	17	34584495	missense	probably damaging	1.00
X0067:Notch4	UTSW	17	34586084	nonsense	probably null
Z1088:Notch4	UTSW	17	34587915	missense	probably damaging	1.00
Z1177:Notch4	UTSW	17	34575148	missense	probably damaging	1.00
Z1177:Notch4	UTSW	17	34587908	missense	probably damaging	0.97
Z1177:Notch4	UTSW	17	34587909	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- AACACTTGCAGCCGACTGTC -3'
(R):5'- AGGAAAAGCGGCGTCTGTTC -3'

Sequencing Primer
(F):5'- ACTGTCGGTTGCCAGGG -3'
(R):5'- CGTCTGTTCCTGCGGAG -3'

Posted On

2016-08-04