Mutagenetix > Incidental Mutation

Incidental Mutation 'R5363:Fkbpl'

422959

Institutional Source

Beutler Lab

Gene Symbol

Fkbpl

Ensembl Gene

ENSMUSG00000033739

Gene Name

FK506 binding protein-like

Synonyms

WAF-1/CIP1 stabilizing protein 39, NG7, DIR1, Ppiase-X, WISp39

MMRRC Submission

042941-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.937) question?

Stock #

R5363 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34644764-34646324 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 34645329 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 24 (A24T)

Ref Sequence

ENSEMBL: ENSMUSP00000037273 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015605] [ENSMUST00000036720] [ENSMUST00000173984] [ENSMUST00000174519] [ENSMUST00000174614] [ENSMUST00000174796]

AlphaFold

O35450

Predicted Effect

probably benign
Transcript: ENSMUST00000015605

SMART Domains

Protein: ENSMUSP00000015605
Gene: ENSMUSG00000015461

Domain	Start	End	E-Value	Type
low complexity region	86	110	N/A	INTRINSIC
internal_repeat_1	113	156	2.55e-13	PROSPERO
low complexity region	162	180	N/A	INTRINSIC
internal_repeat_1	186	230	2.55e-13	PROSPERO
low complexity region	238	255	N/A	INTRINSIC
low complexity region	289	301	N/A	INTRINSIC
BRLZ	320	384	7.08e-15	SMART
low complexity region	415	428	N/A	INTRINSIC
low complexity region	484	497	N/A	INTRINSIC
low complexity region	544	557	N/A	INTRINSIC
low complexity region	667	693	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000036720
AA Change: A24T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000037273
Gene: ENSMUSG00000033739
AA Change: A24T

Domain	Start	End	E-Value	Type
TPR	208	241	2.92e1	SMART
TPR	250	283	4.77e-2	SMART
TPR	284	317	1.89e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173984

SMART Domains

Protein: ENSMUSP00000133516
Gene: ENSMUSG00000015461

Domain	Start	End	E-Value	Type
low complexity region	89	113	N/A	INTRINSIC
internal_repeat_1	116	159	2.54e-13	PROSPERO
low complexity region	165	183	N/A	INTRINSIC
internal_repeat_1	189	233	2.54e-13	PROSPERO
low complexity region	241	258	N/A	INTRINSIC
low complexity region	292	304	N/A	INTRINSIC
BRLZ	323	387	2.9e-17	SMART
low complexity region	418	431	N/A	INTRINSIC
low complexity region	487	500	N/A	INTRINSIC
low complexity region	547	560	N/A	INTRINSIC
low complexity region	670	696	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174519

SMART Domains

Protein: ENSMUSP00000133558
Gene: ENSMUSG00000015461

Domain	Start	End	E-Value	Type
low complexity region	23	47	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174600

Predicted Effect

probably benign
Transcript: ENSMUST00000174614

Predicted Effect

probably benign
Transcript: ENSMUST00000174796

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has similarity to the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. The encoded protein is thought to have a potential role in the induced radioresistance. Also it appears to have some involvement in the control of the cell cycle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality. Heterozygotes develop normally but exhibit enhanced angiogenesis in various experimental and tumor disease models. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030411F24Rik	G	T	2: 148,783,378	L77F	probably damaging	Het
Abca1	A	G	4: 53,132,963	I40T	probably benign	Het
Abca13	T	C	11: 9,277,035	V597A	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc1	A	G	2: 128,650,194		probably null	Het
Ap4e1	G	A	2: 127,037,864		probably null	Het
Apod	T	C	16: 31,311,091	T16A	probably benign	Het
Arrdc5	C	T	17: 56,300,138	V36M	probably damaging	Het
Bcan	A	G	3: 87,995,487	V328A	probably damaging	Het
Bche	A	G	3: 73,700,639	Y485H	probably damaging	Het
Btbd6	A	G	12: 112,978,136	Y356C	probably damaging	Het
Cdh4	A	G	2: 179,886,763	T555A	probably benign	Het
Ciita	C	T	16: 10,512,167	H769Y	probably damaging	Het
Clspn	A	G	4: 126,561,786	D35G	possibly damaging	Het
Cpsf3	T	A	12: 21,308,985	M562K	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cyp2a22	T	A	7: 26,936,433	Q235L	probably damaging	Het
Dicer1	A	G	12: 104,703,151	S1091P	probably damaging	Het
Dync1li1	T	A	9: 114,715,229	I323N	probably damaging	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat4	A	G	3: 38,888,005	N349S	probably damaging	Het
Hectd4	T	C	5: 121,310,603	M338T	probably benign	Het
Lactb2	A	T	1: 13,630,132	I225N	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mrps30	A	G	13: 118,387,162	S25P	probably benign	Het
Myg1	T	C	15: 102,337,824	V378A	probably benign	Het
Notch4	C	T	17: 34,587,123	T1731I	probably damaging	Het
Ntmt1	A	G	2: 30,820,648	D121G	probably damaging	Het
Olfr1167	A	T	2: 88,149,802	D72E	probably damaging	Het
Olfr763	C	A	10: 129,011,914	P210T	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pclo	A	G	5: 14,669,410	D1187G	unknown	Het
Pkd1	T	A	17: 24,565,073	Y198N	probably benign	Het
Plk4	T	A	3: 40,801,984	N83K	possibly damaging	Het
Prune2	A	T	19: 17,118,266	Q378L	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rasa1	G	T	13: 85,288,555	T118K	possibly damaging	Het
Rin3	G	A	12: 102,325,834	V97M	probably damaging	Het
Rock2	T	C	12: 16,965,654		probably null	Het
Slc34a1	A	G	13: 55,403,268	I289V	probably benign	Het
Slc34a1	T	C	13: 55,412,290	L443P	probably damaging	Het
Slco2a1	A	T	9: 103,070,263	I254F	probably damaging	Het
Spink11	T	C	18: 44,195,686	I32V	probably benign	Het
Spire1	T	C	18: 67,506,555	E296G	probably damaging	Het
Sun1	A	G	5: 139,234,743	N410D	probably damaging	Het
Syt14	T	A	1: 192,930,663	T610S	possibly damaging	Het
Tenm3	T	C	8: 48,287,831	I1206V	possibly damaging	Het
Tet3	A	T	6: 83,376,764		probably null	Het
Thbs1	A	T	2: 118,122,666	Q919L	probably damaging	Het
Trappc10	A	G	10: 78,188,840	F1152L	possibly damaging	Het
Trp63	C	A	16: 25,863,718	N176K	probably damaging	Het
Zbtb17	A	G	4: 141,466,761	E700G	probably benign	Het
Zfp446	G	A	7: 12,978,057	R69H	probably benign	Het
Zfy2	C	T	Y: 2,106,555	C693Y	possibly damaging	Het
Zxdc	A	G	6: 90,382,146	T587A	probably damaging	Het
Zyg11a	A	G	4: 108,189,622	C552R	probably damaging	Het

Other mutations in Fkbpl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01085:Fkbpl	APN	17	34645744	missense	probably damaging	1.00
IGL02129:Fkbpl	APN	17	34645978	missense	probably damaging	0.99
IGL02322:Fkbpl	APN	17	34645324	missense	probably benign	0.00
IGL03331:Fkbpl	APN	17	34645687	missense	probably damaging	1.00
IGL03347:Fkbpl	APN	17	34646313	unclassified	probably benign
R0278:Fkbpl	UTSW	17	34645410	nonsense	probably null
R0314:Fkbpl	UTSW	17	34646052	missense	possibly damaging	0.62
R0540:Fkbpl	UTSW	17	34645359	missense	probably benign
R0607:Fkbpl	UTSW	17	34645359	missense	probably benign
R1866:Fkbpl	UTSW	17	34645823	missense	possibly damaging	0.50
R4483:Fkbpl	UTSW	17	34646295	missense	probably damaging	1.00
R4746:Fkbpl	UTSW	17	34645329	missense	probably benign
R4795:Fkbpl	UTSW	17	34645329	missense	probably benign
R4796:Fkbpl	UTSW	17	34645329	missense	probably benign
R4839:Fkbpl	UTSW	17	34645865	missense	probably benign
R5268:Fkbpl	UTSW	17	34645329	missense	probably benign
R5290:Fkbpl	UTSW	17	34645329	missense	probably benign
R5357:Fkbpl	UTSW	17	34645329	missense	probably benign
R5358:Fkbpl	UTSW	17	34645329	missense	probably benign
R5359:Fkbpl	UTSW	17	34645329	missense	probably benign
R5360:Fkbpl	UTSW	17	34645329	missense	probably benign
R5361:Fkbpl	UTSW	17	34645329	missense	probably benign
R5406:Fkbpl	UTSW	17	34645329	missense	probably benign
R5435:Fkbpl	UTSW	17	34645329	missense	probably benign
R5533:Fkbpl	UTSW	17	34645329	missense	probably benign
R5535:Fkbpl	UTSW	17	34645329	missense	probably benign
R5722:Fkbpl	UTSW	17	34645329	missense	probably benign
R5723:Fkbpl	UTSW	17	34645329	missense	probably benign
R5760:Fkbpl	UTSW	17	34645329	missense	probably benign
R5861:Fkbpl	UTSW	17	34645329	missense	probably benign
R5941:Fkbpl	UTSW	17	34645329	missense	probably benign
R6109:Fkbpl	UTSW	17	34645329	missense	probably benign
R6124:Fkbpl	UTSW	17	34645329	missense	probably benign
R6146:Fkbpl	UTSW	17	34645329	missense	probably benign
R6148:Fkbpl	UTSW	17	34645329	missense	probably benign
R6185:Fkbpl	UTSW	17	34645329	missense	probably benign
R6186:Fkbpl	UTSW	17	34645329	missense	probably benign
R6186:Fkbpl	UTSW	17	34646179	missense	probably benign	0.12
R6344:Fkbpl	UTSW	17	34645570	missense	probably damaging	1.00
R6481:Fkbpl	UTSW	17	34645414	missense	possibly damaging	0.95
R6564:Fkbpl	UTSW	17	34646266	missense	probably benign	0.42
R9800:Fkbpl	UTSW	17	34645717	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGAGTCTTAACTAGGAATTCTGG -3'
(R):5'- GGTGCTCTGCCATCTCATTG -3'

Sequencing Primer
(F):5'- AATTCTGGAATTTACATGGTTTCGG -3'
(R):5'- TGGTTGAGACTTGAAATTGATCAGAG -3'

Posted On

2016-08-04