Incidental Mutation 'R5363:Fkbpl'
ID422959
Institutional Source Beutler Lab
Gene Symbol Fkbpl
Ensembl Gene ENSMUSG00000033739
Gene NameFK506 binding protein-like
SynonymsWAF-1/CIP1 stabilizing protein 39, NG7, DIR1, Ppiase-X, WISp39
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R5363 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34644764-34646324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34645329 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 24 (A24T)
Ref Sequence ENSEMBL: ENSMUSP00000037273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015605] [ENSMUST00000036720] [ENSMUST00000173984] [ENSMUST00000174519] [ENSMUST00000174614] [ENSMUST00000174796]
Predicted Effect probably benign
Transcript: ENSMUST00000015605
SMART Domains Protein: ENSMUSP00000015605
Gene: ENSMUSG00000015461

DomainStartEndE-ValueType
low complexity region 86 110 N/A INTRINSIC
internal_repeat_1 113 156 2.55e-13 PROSPERO
low complexity region 162 180 N/A INTRINSIC
internal_repeat_1 186 230 2.55e-13 PROSPERO
low complexity region 238 255 N/A INTRINSIC
low complexity region 289 301 N/A INTRINSIC
BRLZ 320 384 7.08e-15 SMART
low complexity region 415 428 N/A INTRINSIC
low complexity region 484 497 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036720
AA Change: A24T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037273
Gene: ENSMUSG00000033739
AA Change: A24T

DomainStartEndE-ValueType
TPR 208 241 2.92e1 SMART
TPR 250 283 4.77e-2 SMART
TPR 284 317 1.89e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173984
SMART Domains Protein: ENSMUSP00000133516
Gene: ENSMUSG00000015461

DomainStartEndE-ValueType
low complexity region 89 113 N/A INTRINSIC
internal_repeat_1 116 159 2.54e-13 PROSPERO
low complexity region 165 183 N/A INTRINSIC
internal_repeat_1 189 233 2.54e-13 PROSPERO
low complexity region 241 258 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
BRLZ 323 387 2.9e-17 SMART
low complexity region 418 431 N/A INTRINSIC
low complexity region 487 500 N/A INTRINSIC
low complexity region 547 560 N/A INTRINSIC
low complexity region 670 696 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174519
SMART Domains Protein: ENSMUSP00000133558
Gene: ENSMUSG00000015461

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174600
Predicted Effect probably benign
Transcript: ENSMUST00000174614
Predicted Effect probably benign
Transcript: ENSMUST00000174796
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has similarity to the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. The encoded protein is thought to have a potential role in the induced radioresistance. Also it appears to have some involvement in the control of the cell cycle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality. Heterozygotes develop normally but exhibit enhanced angiogenesis in various experimental and tumor disease models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zfy2 C T Y: 2,106,555 C693Y possibly damaging Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Fkbpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Fkbpl APN 17 34645744 missense probably damaging 1.00
IGL02129:Fkbpl APN 17 34645978 missense probably damaging 0.99
IGL02322:Fkbpl APN 17 34645324 missense probably benign 0.00
IGL03331:Fkbpl APN 17 34645687 missense probably damaging 1.00
IGL03347:Fkbpl APN 17 34646313 unclassified probably benign
R0278:Fkbpl UTSW 17 34645410 nonsense probably null
R0314:Fkbpl UTSW 17 34646052 missense possibly damaging 0.62
R0540:Fkbpl UTSW 17 34645359 missense probably benign
R0607:Fkbpl UTSW 17 34645359 missense probably benign
R1866:Fkbpl UTSW 17 34645823 missense possibly damaging 0.50
R4483:Fkbpl UTSW 17 34646295 missense probably damaging 1.00
R4746:Fkbpl UTSW 17 34645329 missense probably benign
R4795:Fkbpl UTSW 17 34645329 missense probably benign
R4796:Fkbpl UTSW 17 34645329 missense probably benign
R4839:Fkbpl UTSW 17 34645865 missense probably benign
R5268:Fkbpl UTSW 17 34645329 missense probably benign
R5290:Fkbpl UTSW 17 34645329 missense probably benign
R5357:Fkbpl UTSW 17 34645329 missense probably benign
R5358:Fkbpl UTSW 17 34645329 missense probably benign
R5359:Fkbpl UTSW 17 34645329 missense probably benign
R5360:Fkbpl UTSW 17 34645329 missense probably benign
R5361:Fkbpl UTSW 17 34645329 missense probably benign
R5406:Fkbpl UTSW 17 34645329 missense probably benign
R5435:Fkbpl UTSW 17 34645329 missense probably benign
R5533:Fkbpl UTSW 17 34645329 missense probably benign
R5535:Fkbpl UTSW 17 34645329 missense probably benign
R5722:Fkbpl UTSW 17 34645329 missense probably benign
R5723:Fkbpl UTSW 17 34645329 missense probably benign
R5760:Fkbpl UTSW 17 34645329 missense probably benign
R5861:Fkbpl UTSW 17 34645329 missense probably benign
R5941:Fkbpl UTSW 17 34645329 missense probably benign
R6109:Fkbpl UTSW 17 34645329 missense probably benign
R6124:Fkbpl UTSW 17 34645329 missense probably benign
R6146:Fkbpl UTSW 17 34645329 missense probably benign
R6148:Fkbpl UTSW 17 34645329 missense probably benign
R6185:Fkbpl UTSW 17 34645329 missense probably benign
R6186:Fkbpl UTSW 17 34645329 missense probably benign
R6186:Fkbpl UTSW 17 34646179 missense probably benign 0.12
R6344:Fkbpl UTSW 17 34645570 missense probably damaging 1.00
R6481:Fkbpl UTSW 17 34645414 missense possibly damaging 0.95
R6564:Fkbpl UTSW 17 34646266 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- AGGAGTCTTAACTAGGAATTCTGG -3'
(R):5'- GGTGCTCTGCCATCTCATTG -3'

Sequencing Primer
(F):5'- AATTCTGGAATTTACATGGTTTCGG -3'
(R):5'- TGGTTGAGACTTGAAATTGATCAGAG -3'
Posted On2016-08-04