Incidental Mutation 'R5363:Zfy2'
ID422964
Institutional Source Beutler Lab
Gene Symbol Zfy2
Ensembl Gene ENSMUSG00000000103
Gene Namezinc finger protein 2, Y-linked
SynonymsZfy-2
MMRRC Submission 042941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5363 (G1)
Quality Score222
Status Not validated
ChromosomeY
Chromosomal Location2106015-2170409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 2106555 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 693 (C693Y)
Ref Sequence ENSEMBL: ENSMUSP00000139591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115891] [ENSMUST00000187148]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115891
AA Change: C693Y

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111557
Gene: ENSMUSG00000000103
AA Change: C693Y

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 68 388 1.1e-115 PFAM
ZnF_C2H2 403 425 3.69e-4 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 491 514 1.41e0 SMART
ZnF_C2H2 520 542 3.69e-4 SMART
ZnF_C2H2 548 571 3.63e-3 SMART
ZnF_C2H2 577 599 1.02e1 SMART
ZnF_C2H2 605 628 3.58e-2 SMART
ZnF_C2H2 634 656 2.95e-3 SMART
ZnF_C2H2 662 685 1.23e0 SMART
ZnF_C2H2 691 713 1.45e-2 SMART
ZnF_C2H2 719 742 1.2e-3 SMART
ZnF_C2H2 748 770 3.34e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000187148
AA Change: C693Y

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139591
Gene: ENSMUSG00000000103
AA Change: C693Y

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 67 388 2.6e-149 PFAM
ZnF_C2H2 403 425 3.69e-4 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 491 514 1.41e0 SMART
ZnF_C2H2 520 542 3.69e-4 SMART
ZnF_C2H2 548 571 3.63e-3 SMART
ZnF_C2H2 577 599 1.02e1 SMART
ZnF_C2H2 605 628 3.58e-2 SMART
ZnF_C2H2 634 656 2.95e-3 SMART
ZnF_C2H2 662 685 1.23e0 SMART
ZnF_C2H2 691 713 1.45e-2 SMART
ZnF_C2H2 719 742 1.2e-3 SMART
ZnF_C2H2 748 770 3.34e-2 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Abca1 A G 4: 53,132,963 I40T probably benign Het
Abca13 T C 11: 9,277,035 V597A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc1 A G 2: 128,650,194 probably null Het
Ap4e1 G A 2: 127,037,864 probably null Het
Apod T C 16: 31,311,091 T16A probably benign Het
Arrdc5 C T 17: 56,300,138 V36M probably damaging Het
Bcan A G 3: 87,995,487 V328A probably damaging Het
Bche A G 3: 73,700,639 Y485H probably damaging Het
Btbd6 A G 12: 112,978,136 Y356C probably damaging Het
Cdh4 A G 2: 179,886,763 T555A probably benign Het
Ciita C T 16: 10,512,167 H769Y probably damaging Het
Clspn A G 4: 126,561,786 D35G possibly damaging Het
Cpsf3 T A 12: 21,308,985 M562K probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cyp2a22 T A 7: 26,936,433 Q235L probably damaging Het
Dicer1 A G 12: 104,703,151 S1091P probably damaging Het
Dync1li1 T A 9: 114,715,229 I323N probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat4 A G 3: 38,888,005 N349S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hectd4 T C 5: 121,310,603 M338T probably benign Het
Lactb2 A T 1: 13,630,132 I225N probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mrps30 A G 13: 118,387,162 S25P probably benign Het
Myg1 T C 15: 102,337,824 V378A probably benign Het
Notch4 C T 17: 34,587,123 T1731I probably damaging Het
Ntmt1 A G 2: 30,820,648 D121G probably damaging Het
Olfr1167 A T 2: 88,149,802 D72E probably damaging Het
Olfr763 C A 10: 129,011,914 P210T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pclo A G 5: 14,669,410 D1187G unknown Het
Pkd1 T A 17: 24,565,073 Y198N probably benign Het
Plk4 T A 3: 40,801,984 N83K possibly damaging Het
Prune2 A T 19: 17,118,266 Q378L probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa1 G T 13: 85,288,555 T118K possibly damaging Het
Rin3 G A 12: 102,325,834 V97M probably damaging Het
Rock2 T C 12: 16,965,654 probably null Het
Slc34a1 A G 13: 55,403,268 I289V probably benign Het
Slc34a1 T C 13: 55,412,290 L443P probably damaging Het
Slco2a1 A T 9: 103,070,263 I254F probably damaging Het
Spink11 T C 18: 44,195,686 I32V probably benign Het
Spire1 T C 18: 67,506,555 E296G probably damaging Het
Sun1 A G 5: 139,234,743 N410D probably damaging Het
Syt14 T A 1: 192,930,663 T610S possibly damaging Het
Tenm3 T C 8: 48,287,831 I1206V possibly damaging Het
Tet3 A T 6: 83,376,764 probably null Het
Thbs1 A T 2: 118,122,666 Q919L probably damaging Het
Trappc10 A G 10: 78,188,840 F1152L possibly damaging Het
Trp63 C A 16: 25,863,718 N176K probably damaging Het
Zbtb17 A G 4: 141,466,761 E700G probably benign Het
Zfp446 G A 7: 12,978,057 R69H probably benign Het
Zxdc A G 6: 90,382,146 T587A probably damaging Het
Zyg11a A G 4: 108,189,622 C552R probably damaging Het
Other mutations in Zfy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02850:Zfy2 APN Y 2106894 missense probably benign 0.01
IGL02850:Zfy2 APN Y 2117188 missense probably benign 0.00
IGL02851:Zfy2 APN Y 2106894 missense probably benign 0.01
IGL02851:Zfy2 APN Y 2117188 missense probably benign 0.00
IGL02852:Zfy2 APN Y 2106894 missense probably benign 0.01
IGL02852:Zfy2 APN Y 2117188 missense probably benign 0.00
PIT4515001:Zfy2 UTSW Y 2117096 missense probably benign 0.09
R0426:Zfy2 UTSW Y 2107348 missense possibly damaging 0.61
R0490:Zfy2 UTSW Y 2106620 missense possibly damaging 0.89
R1080:Zfy2 UTSW Y 2121645 missense probably benign 0.00
R1513:Zfy2 UTSW Y 2116185 missense probably benign 0.00
R1935:Zfy2 UTSW Y 2121496 missense probably benign 0.02
R1936:Zfy2 UTSW Y 2121496 missense probably benign 0.02
R2358:Zfy2 UTSW Y 2107272 missense possibly damaging 0.61
R4484:Zfy2 UTSW Y 2107351 missense possibly damaging 0.86
R4754:Zfy2 UTSW Y 2121477 missense probably benign 0.02
R4777:Zfy2 UTSW Y 2116194 missense probably benign 0.00
R4812:Zfy2 UTSW Y 2106334 missense probably benign 0.08
R5045:Zfy2 UTSW Y 2107159 missense possibly damaging 0.77
R6256:Zfy2 UTSW Y 2116267 missense probably benign 0.02
R6618:Zfy2 UTSW Y 2121477 missense probably benign 0.10
R6941:Zfy2 UTSW Y 2121491 missense probably benign 0.02
R7011:Zfy2 UTSW Y 2107127 missense possibly damaging 0.59
R7712:Zfy2 UTSW Y 2121420 missense probably benign 0.05
R7759:Zfy2 UTSW Y 2117083 missense probably benign 0.02
R7985:Zfy2 UTSW Y 2116263 missense probably benign 0.00
R8051:Zfy2 UTSW Y 2117380 intron probably benign
R8218:Zfy2 UTSW Y 2133421 missense unknown
R8345:Zfy2 UTSW Y 2107096 missense possibly damaging 0.95
R8371:Zfy2 UTSW Y 2117168 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCGGAATCCTTTCTTGCAG -3'
(R):5'- TCCGTTCACACAAAGGCGTATC -3'

Sequencing Primer
(F):5'- TTCTTGCAGAAGTCACAGCG -3'
(R):5'- CCTCATAAATGTGACATGTGCAGC -3'
Posted On2016-08-04