Mutagenetix > Incidental Mutation

Incidental Mutation 'R5364:Tbx15'

422980

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

042942-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.935) question?

Stock #

R5364 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 99352192 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 460 (S460C)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462]

AlphaFold

O70306

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029462
AA Change: S460C

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: S460C

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Meta Mutation Damage Score

0.0752

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.3%

Validation Efficiency

100% (102/102)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	C	G	7: 27,578,767	T242R	probably damaging	Het
Abcc10	G	A	17: 46,305,651	R1205C	probably benign	Het
Acer1	A	G	17: 56,982,000	F37L	probably damaging	Het
Acp7	C	A	7: 28,611,023	G463V	probably benign	Het
Actr2	A	T	11: 20,100,797		probably benign	Het
Adam15	A	T	3: 89,345,595	I272K	probably damaging	Het
Adam1b	T	A	5: 121,500,883	I700F	possibly damaging	Het
Adam33	A	G	2: 131,054,472		probably null	Het
Ano1	T	C	7: 144,637,204	Y380C	probably damaging	Het
Arfgap3	A	C	15: 83,314,361	M307R	probably damaging	Het
Arhgap21	T	A	2: 20,849,722	R1610W	probably damaging	Het
Bbs2	A	G	8: 94,074,395	Y603H	probably benign	Het
Bbs9	G	T	9: 22,575,196		probably null	Het
Bcar3	A	C	3: 122,529,632	M779L	probably benign	Het
Bub3	A	T	7: 131,560,738	N10I	possibly damaging	Het
Cacna1c	T	G	6: 118,656,543	E1098D	probably benign	Het
Cacna1g	T	A	11: 94,416,858	M1738L	probably benign	Het
Camk2d	G	T	3: 126,780,420	G159C	probably damaging	Het
Ccdc114	T	A	7: 45,936,332	I105N	probably damaging	Het
Ccdc51	A	T	9: 109,092,120	E358D	possibly damaging	Het
Cdc42bpa	A	G	1: 180,067,182	D309G	probably benign	Het
Cdhr3	A	T	12: 33,051,008	F468I	possibly damaging	Het
Chrd	A	G	16: 20,733,148	M1V	probably null	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Dcdc2b	T	C	4: 129,609,170	Y253C	probably damaging	Het
Dclk1	A	C	3: 55,255,945	N153H	possibly damaging	Het
Dgkg	G	T	16: 22,600,461	S96R	probably benign	Het
Dnah9	A	G	11: 65,881,696	Y3737H	possibly damaging	Het
Elovl4	A	T	9: 83,790,023	I81N	probably benign	Het
Epha7	T	A	4: 28,950,557	Y791N	probably damaging	Het
Fam105a	G	A	15: 27,659,945	Q24*	probably null	Het
Fam193a	C	A	5: 34,466,253	T1395N	probably benign	Het
Fbln5	A	T	12: 101,771,364	V141E	probably damaging	Het
Flii	T	C	11: 60,720,128	T492A	probably benign	Het
Fnip2	A	G	3: 79,481,168	I752T	probably benign	Het
Fpr3	T	C	17: 17,970,544	W26R	probably benign	Het
Gabrb1	A	T	5: 72,136,762	T460S	probably benign	Het
Gde1	T	C	7: 118,698,651	N4S	probably benign	Het
Ghitm	G	T	14: 37,125,199	T306K	probably benign	Het
Ghitm	A	T	14: 37,125,217	I300N	probably damaging	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Iqcd	T	C	5: 120,600,267	I50T	probably damaging	Het
Itpripl1	G	A	2: 127,141,819	P128S	possibly damaging	Het
Jag2	C	A	12: 112,910,534	L1000F	probably damaging	Het
Klhdc4	A	T	8: 121,806,636		probably benign	Het
Klra5	A	G	6: 129,899,353	F164L	probably benign	Het
Larp1b	A	G	3: 40,977,223	Y288C	probably damaging	Het
Lrfn3	T	A	7: 30,355,653	E622D	possibly damaging	Het
Lyst	A	G	13: 13,656,854	D1621G	probably benign	Het
Mastl	T	C	2: 23,133,653	T353A	probably benign	Het
Mkln1	T	C	6: 31,496,712	Y130H	probably damaging	Het
Mms22l	T	A	4: 24,496,882		probably benign	Het
Mroh7	T	A	4: 106,691,643	M1008L	probably benign	Het
Nipal1	T	C	5: 72,667,900	V312A	probably damaging	Het
Nlrp5	T	A	7: 23,418,328	Y492*	probably null	Het
Olfr351	T	C	2: 36,859,994	Y118C	probably damaging	Het
Pcdhb11	T	A	18: 37,422,179	D187E	probably benign	Het
Pcdhb13	A	G	18: 37,443,508	Y313C	probably damaging	Het
Pdpn	G	A	4: 143,273,956	T102I	possibly damaging	Het
Pear1	A	T	3: 87,758,361	C120S	probably damaging	Het
Peg10	T	C	6: 4,756,128		probably benign	Het
Ppm1e	A	G	11: 87,237,181	W384R	probably benign	Het
Ppp1r10	C	T	17: 35,930,432	P700S	unknown	Het
Prl2c5	G	A	13: 13,183,042	R13K	probably benign	Het
Prmt3	C	A	7: 49,848,806	P487T	probably damaging	Het
Proser3	C	A	7: 30,546,148	A144S	possibly damaging	Het
Ptcd1	G	A	5: 145,151,431	T590I	probably damaging	Het
Rbsn	A	G	6: 92,193,977	V321A	probably damaging	Het
Slc40a1	C	A	1: 45,925,223	C14F	probably damaging	Het
Slc6a15	T	C	10: 103,393,508	I136T	probably damaging	Het
Slc7a4	A	G	16: 17,573,363	I449T	probably benign	Het
Snrnp48	T	A	13: 38,210,189		probably null	Het
Tada2a	A	G	11: 84,121,147	Y23H	probably benign	Het
Tbx21	C	T	11: 97,101,478		probably null	Het
Tmcc2	T	G	1: 132,357,796	T376P	probably damaging	Het
Tmco4	G	A	4: 139,052,504	C420Y	probably damaging	Het
Tmem235	C	A	11: 117,864,194	Y157*	probably null	Het
Tmem63b	T	C	17: 45,664,727		probably benign	Het
Tnfrsf1a	T	C	6: 125,357,393	S92P	possibly damaging	Het
Top3b	A	T	16: 16,886,970	T397S	probably benign	Het
Trabd	C	A	15: 89,082,804		probably benign	Het
Trbv21	A	T	6: 41,202,830	I27L	possibly damaging	Het
Trim3	C	T	7: 105,619,069	V169M	probably damaging	Het
Ttn	C	T	2: 76,908,516	S3893N	probably benign	Het
Ttn	T	C	2: 76,977,114	T92A	probably damaging	Het
Uchl4	A	T	9: 64,235,539	I101F	possibly damaging	Het
Vmn1r5	T	A	6: 56,985,598	M86K	probably damaging	Het
Vmn2r55	T	A	7: 12,670,903	Q191L	possibly damaging	Het
Zfp458	A	T	13: 67,257,948	C139*	probably null	Het
Zfp788	T	C	7: 41,650,127	L729P	probably damaging	Het
Zmym2	T	A	14: 56,920,645	M547K	possibly damaging	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGATTATCCACCATGTGCCCG -3'
(R):5'- TTCTCTGGGCTTGCAGCTAG -3'

Sequencing Primer
(F):5'- GAAGCAACATGGCTGCCTTAC -3'
(R):5'- GGGGAAATTGTATCCATACAGATTG -3'

Posted On

2016-08-04