Incidental Mutation 'R5364:Bcar3'
ID422981
Institutional Source Beutler Lab
Gene Symbol Bcar3
Ensembl Gene ENSMUSG00000028121
Gene Namebreast cancer anti-estrogen resistance 3
SynonymsAND-34
MMRRC Submission 042942-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.702) question?
Stock #R5364 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location122294136-122530191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 122529632 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 779 (M779L)
Ref Sequence ENSEMBL: ENSMUSP00000029766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029766]
Predicted Effect probably benign
Transcript: ENSMUST00000029766
AA Change: M779L

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029766
Gene: ENSMUSG00000028121
AA Change: M779L

DomainStartEndE-ValueType
low complexity region 126 145 N/A INTRINSIC
SH2 146 234 3.17e-21 SMART
low complexity region 395 406 N/A INTRINSIC
RasGEF 539 814 2.55e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197959
Meta Mutation Damage Score 0.0761 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.3%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breast tumors are initially dependent on estrogens for growth and progression and can be inhibited by anti-estrogens such as tamoxifen. However, breast cancers progress to become anti-estrogen resistant. Breast cancer anti-estrogen resistance gene 3 was identified in the search for genes involved in the development of estrogen resistance. The gene encodes a component of intracellular signal transduction that causes estrogen-independent proliferation in human breast cancer cells. The protein contains a putative src homology 2 (SH2) domain, a hall mark of cellular tyrosine kinase signaling molecules, and is partly homologous to the cell division cycle protein CDC48. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit cataracts due to rupture of the lens capsule and liquefaction of lens cortical fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C G 7: 27,578,767 T242R probably damaging Het
Abcc10 G A 17: 46,305,651 R1205C probably benign Het
Acer1 A G 17: 56,982,000 F37L probably damaging Het
Acp7 C A 7: 28,611,023 G463V probably benign Het
Actr2 A T 11: 20,100,797 probably benign Het
Adam15 A T 3: 89,345,595 I272K probably damaging Het
Adam1b T A 5: 121,500,883 I700F possibly damaging Het
Adam33 A G 2: 131,054,472 probably null Het
Ano1 T C 7: 144,637,204 Y380C probably damaging Het
Arfgap3 A C 15: 83,314,361 M307R probably damaging Het
Arhgap21 T A 2: 20,849,722 R1610W probably damaging Het
Bbs2 A G 8: 94,074,395 Y603H probably benign Het
Bbs9 G T 9: 22,575,196 probably null Het
Bub3 A T 7: 131,560,738 N10I possibly damaging Het
Cacna1c T G 6: 118,656,543 E1098D probably benign Het
Cacna1g T A 11: 94,416,858 M1738L probably benign Het
Camk2d G T 3: 126,780,420 G159C probably damaging Het
Ccdc114 T A 7: 45,936,332 I105N probably damaging Het
Ccdc51 A T 9: 109,092,120 E358D possibly damaging Het
Cdc42bpa A G 1: 180,067,182 D309G probably benign Het
Cdhr3 A T 12: 33,051,008 F468I possibly damaging Het
Chrd A G 16: 20,733,148 M1V probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcdc2b T C 4: 129,609,170 Y253C probably damaging Het
Dclk1 A C 3: 55,255,945 N153H possibly damaging Het
Dgkg G T 16: 22,600,461 S96R probably benign Het
Dnah9 A G 11: 65,881,696 Y3737H possibly damaging Het
Elovl4 A T 9: 83,790,023 I81N probably benign Het
Epha7 T A 4: 28,950,557 Y791N probably damaging Het
Fam105a G A 15: 27,659,945 Q24* probably null Het
Fam193a C A 5: 34,466,253 T1395N probably benign Het
Fbln5 A T 12: 101,771,364 V141E probably damaging Het
Flii T C 11: 60,720,128 T492A probably benign Het
Fnip2 A G 3: 79,481,168 I752T probably benign Het
Fpr3 T C 17: 17,970,544 W26R probably benign Het
Gabrb1 A T 5: 72,136,762 T460S probably benign Het
Gde1 T C 7: 118,698,651 N4S probably benign Het
Ghitm G T 14: 37,125,199 T306K probably benign Het
Ghitm A T 14: 37,125,217 I300N probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Iqcd T C 5: 120,600,267 I50T probably damaging Het
Itpripl1 G A 2: 127,141,819 P128S possibly damaging Het
Jag2 C A 12: 112,910,534 L1000F probably damaging Het
Klhdc4 A T 8: 121,806,636 probably benign Het
Klra5 A G 6: 129,899,353 F164L probably benign Het
Larp1b A G 3: 40,977,223 Y288C probably damaging Het
Lrfn3 T A 7: 30,355,653 E622D possibly damaging Het
Lyst A G 13: 13,656,854 D1621G probably benign Het
Mastl T C 2: 23,133,653 T353A probably benign Het
Mkln1 T C 6: 31,496,712 Y130H probably damaging Het
Mms22l T A 4: 24,496,882 probably benign Het
Mroh7 T A 4: 106,691,643 M1008L probably benign Het
Nipal1 T C 5: 72,667,900 V312A probably damaging Het
Nlrp5 T A 7: 23,418,328 Y492* probably null Het
Olfr351 T C 2: 36,859,994 Y118C probably damaging Het
Pcdhb11 T A 18: 37,422,179 D187E probably benign Het
Pcdhb13 A G 18: 37,443,508 Y313C probably damaging Het
Pdpn G A 4: 143,273,956 T102I possibly damaging Het
Pear1 A T 3: 87,758,361 C120S probably damaging Het
Peg10 T C 6: 4,756,128 probably benign Het
Ppm1e A G 11: 87,237,181 W384R probably benign Het
Ppp1r10 C T 17: 35,930,432 P700S unknown Het
Prl2c5 G A 13: 13,183,042 R13K probably benign Het
Prmt3 C A 7: 49,848,806 P487T probably damaging Het
Proser3 C A 7: 30,546,148 A144S possibly damaging Het
Ptcd1 G A 5: 145,151,431 T590I probably damaging Het
Rbsn A G 6: 92,193,977 V321A probably damaging Het
Slc40a1 C A 1: 45,925,223 C14F probably damaging Het
Slc6a15 T C 10: 103,393,508 I136T probably damaging Het
Slc7a4 A G 16: 17,573,363 I449T probably benign Het
Snrnp48 T A 13: 38,210,189 probably null Het
Tada2a A G 11: 84,121,147 Y23H probably benign Het
Tbx15 A T 3: 99,352,192 S460C possibly damaging Het
Tbx21 C T 11: 97,101,478 probably null Het
Tmcc2 T G 1: 132,357,796 T376P probably damaging Het
Tmco4 G A 4: 139,052,504 C420Y probably damaging Het
Tmem235 C A 11: 117,864,194 Y157* probably null Het
Tmem63b T C 17: 45,664,727 probably benign Het
Tnfrsf1a T C 6: 125,357,393 S92P possibly damaging Het
Top3b A T 16: 16,886,970 T397S probably benign Het
Trabd C A 15: 89,082,804 probably benign Het
Trbv21 A T 6: 41,202,830 I27L possibly damaging Het
Trim3 C T 7: 105,619,069 V169M probably damaging Het
Ttn C T 2: 76,908,516 S3893N probably benign Het
Ttn T C 2: 76,977,114 T92A probably damaging Het
Uchl4 A T 9: 64,235,539 I101F possibly damaging Het
Vmn1r5 T A 6: 56,985,598 M86K probably damaging Het
Vmn2r55 T A 7: 12,670,903 Q191L possibly damaging Het
Zfp458 A T 13: 67,257,948 C139* probably null Het
Zfp788 T C 7: 41,650,127 L729P probably damaging Het
Zmym2 T A 14: 56,920,645 M547K possibly damaging Het
Other mutations in Bcar3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Bcar3 APN 3 122512936 missense probably benign 0.36
IGL01372:Bcar3 APN 3 122523294 missense probably damaging 1.00
IGL02681:Bcar3 APN 3 122512768 unclassified probably null
IGL03403:Bcar3 APN 3 122512969 missense probably benign 0.01
R0408:Bcar3 UTSW 3 122508384 missense probably damaging 0.98
R0531:Bcar3 UTSW 3 122426499 missense probably benign 0.00
R0798:Bcar3 UTSW 3 122525299 missense probably benign 0.01
R1445:Bcar3 UTSW 3 122523191 missense probably damaging 0.98
R1892:Bcar3 UTSW 3 122508136 missense probably benign 0.00
R2138:Bcar3 UTSW 3 122512996 missense probably damaging 1.00
R3236:Bcar3 UTSW 3 122524996 missense probably benign 0.02
R3237:Bcar3 UTSW 3 122524996 missense probably benign 0.02
R3832:Bcar3 UTSW 3 122426649 missense probably damaging 1.00
R4801:Bcar3 UTSW 3 122529594 missense probably benign 0.22
R4802:Bcar3 UTSW 3 122529594 missense probably benign 0.22
R5342:Bcar3 UTSW 3 122426649 missense probably damaging 1.00
R5560:Bcar3 UTSW 3 122426575 missense possibly damaging 0.92
R5714:Bcar3 UTSW 3 122455087 missense possibly damaging 0.88
R5716:Bcar3 UTSW 3 122512915 missense probably damaging 1.00
R5944:Bcar3 UTSW 3 122523283 missense probably benign
R6478:Bcar3 UTSW 3 122426576 missense probably benign 0.04
R6615:Bcar3 UTSW 3 122426633 missense probably benign 0.00
R6996:Bcar3 UTSW 3 122508384 missense possibly damaging 0.95
R7272:Bcar3 UTSW 3 122508396 missense possibly damaging 0.92
R7308:Bcar3 UTSW 3 122508493 missense probably benign 0.00
R7353:Bcar3 UTSW 3 122512692 missense probably benign 0.00
R7465:Bcar3 UTSW 3 122523230 missense probably benign 0.13
R7816:Bcar3 UTSW 3 122426694 missense probably benign 0.00
R7899:Bcar3 UTSW 3 122508253 missense probably damaging 0.97
R7982:Bcar3 UTSW 3 122508253 missense probably damaging 0.97
R8066:Bcar3 UTSW 3 122524924 missense probably damaging 1.00
Z1177:Bcar3 UTSW 3 122505018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTTGAAGCTGACAAATGCCC -3'
(R):5'- TTACTTAGAGTTGACAGGCATGCC -3'

Sequencing Primer
(F):5'- TTTGAAGCTGACAAATGCCCTACATC -3'
(R):5'- TTGACAGGCATGCCCAGTG -3'
Posted On2016-08-04