Incidental Mutation 'R5364:Tmem235'
ID 423036
Institutional Source Beutler Lab
Gene Symbol Tmem235
Ensembl Gene ENSMUSG00000070330
Gene Name transmembrane protein 235
Synonyms Gm12581, Tmem235, Cldn27
MMRRC Submission 042942-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.048) question?
Stock # R5364 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 117751578-117756369 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 117755020 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 157 (Y157*)
Ref Sequence ENSEMBL: ENSMUSP00000091432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033230] [ENSMUST00000093905]
AlphaFold B1AQL3
Predicted Effect probably benign
Transcript: ENSMUST00000033230
SMART Domains Protein: ENSMUSP00000033230
Gene: ENSMUSG00000017713

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Beta_elim_lyase 42 334 4.6e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000093905
AA Change: Y157*
SMART Domains Protein: ENSMUSP00000091432
Gene: ENSMUSG00000070330
AA Change: Y157*

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 190 9.7e-14 PFAM
Pfam:Claudin_2 16 192 1.3e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153989
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.3%
Validation Efficiency 100% (102/102)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C G 7: 27,278,192 (GRCm39) T242R probably damaging Het
Abcc10 G A 17: 46,616,577 (GRCm39) R1205C probably benign Het
Acer1 A G 17: 57,289,000 (GRCm39) F37L probably damaging Het
Acp7 C A 7: 28,310,448 (GRCm39) G463V probably benign Het
Actr2 A T 11: 20,050,797 (GRCm39) probably benign Het
Adam15 A T 3: 89,252,902 (GRCm39) I272K probably damaging Het
Adam1b T A 5: 121,638,946 (GRCm39) I700F possibly damaging Het
Adam33 A G 2: 130,896,392 (GRCm39) probably null Het
Ano1 T C 7: 144,190,941 (GRCm39) Y380C probably damaging Het
Arfgap3 A C 15: 83,198,562 (GRCm39) M307R probably damaging Het
Arhgap21 T A 2: 20,854,533 (GRCm39) R1610W probably damaging Het
Bbs2 A G 8: 94,801,023 (GRCm39) Y603H probably benign Het
Bbs9 G T 9: 22,486,492 (GRCm39) probably null Het
Bcar3 A C 3: 122,323,281 (GRCm39) M779L probably benign Het
Bub3 A T 7: 131,162,467 (GRCm39) N10I possibly damaging Het
Cacna1c T G 6: 118,633,504 (GRCm39) E1098D probably benign Het
Cacna1g T A 11: 94,307,684 (GRCm39) M1738L probably benign Het
Camk2d G T 3: 126,574,069 (GRCm39) G159C probably damaging Het
Ccdc51 A T 9: 108,921,188 (GRCm39) E358D possibly damaging Het
Cdc42bpa A G 1: 179,894,747 (GRCm39) D309G probably benign Het
Cdhr3 A T 12: 33,101,007 (GRCm39) F468I possibly damaging Het
Chrd A G 16: 20,551,898 (GRCm39) M1V probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 105,036,102 (GRCm39) probably benign Het
Dcdc2b T C 4: 129,502,963 (GRCm39) Y253C probably damaging Het
Dclk1 A C 3: 55,163,366 (GRCm39) N153H possibly damaging Het
Dgkg G T 16: 22,419,211 (GRCm39) S96R probably benign Het
Dnah9 A G 11: 65,772,522 (GRCm39) Y3737H possibly damaging Het
Elovl4 A T 9: 83,672,076 (GRCm39) I81N probably benign Het
Epha7 T A 4: 28,950,557 (GRCm39) Y791N probably damaging Het
Fam193a C A 5: 34,623,597 (GRCm39) T1395N probably benign Het
Fbln5 A T 12: 101,737,623 (GRCm39) V141E probably damaging Het
Flii T C 11: 60,610,954 (GRCm39) T492A probably benign Het
Fnip2 A G 3: 79,388,475 (GRCm39) I752T probably benign Het
Fpr3 T C 17: 18,190,806 (GRCm39) W26R probably benign Het
Gabrb1 A T 5: 72,294,105 (GRCm39) T460S probably benign Het
Gde1 T C 7: 118,297,874 (GRCm39) N4S probably benign Het
Ghitm G T 14: 36,847,156 (GRCm39) T306K probably benign Het
Ghitm A T 14: 36,847,174 (GRCm39) I300N probably damaging Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Iqcd T C 5: 120,738,332 (GRCm39) I50T probably damaging Het
Itpripl1 G A 2: 126,983,739 (GRCm39) P128S possibly damaging Het
Jag2 C A 12: 112,874,154 (GRCm39) L1000F probably damaging Het
Klhdc4 A T 8: 122,533,375 (GRCm39) probably benign Het
Klra5 A G 6: 129,876,316 (GRCm39) F164L probably benign Het
Larp1b A G 3: 40,931,658 (GRCm39) Y288C probably damaging Het
Lrfn3 T A 7: 30,055,078 (GRCm39) E622D possibly damaging Het
Lyst A G 13: 13,831,439 (GRCm39) D1621G probably benign Het
Mastl T C 2: 23,023,665 (GRCm39) T353A probably benign Het
Mkln1 T C 6: 31,473,647 (GRCm39) Y130H probably damaging Het
Mms22l T A 4: 24,496,882 (GRCm39) probably benign Het
Mroh7 T A 4: 106,548,840 (GRCm39) M1008L probably benign Het
Nipal1 T C 5: 72,825,243 (GRCm39) V312A probably damaging Het
Nlrp5 T A 7: 23,117,753 (GRCm39) Y492* probably null Het
Odad1 T A 7: 45,585,756 (GRCm39) I105N probably damaging Het
Or1n1 T C 2: 36,750,006 (GRCm39) Y118C probably damaging Het
Otulinl G A 15: 27,660,031 (GRCm39) Q24* probably null Het
Pcdhb11 T A 18: 37,555,232 (GRCm39) D187E probably benign Het
Pcdhb13 A G 18: 37,576,561 (GRCm39) Y313C probably damaging Het
Pdpn G A 4: 143,000,526 (GRCm39) T102I possibly damaging Het
Pear1 A T 3: 87,665,668 (GRCm39) C120S probably damaging Het
Peg10 T C 6: 4,756,128 (GRCm39) probably benign Het
Ppm1e A G 11: 87,128,007 (GRCm39) W384R probably benign Het
Ppp1r10 C T 17: 36,241,324 (GRCm39) P700S unknown Het
Prl2c5 G A 13: 13,357,627 (GRCm39) R13K probably benign Het
Prmt3 C A 7: 49,498,554 (GRCm39) P487T probably damaging Het
Proser3 C A 7: 30,245,573 (GRCm39) A144S possibly damaging Het
Ptcd1 G A 5: 145,088,241 (GRCm39) T590I probably damaging Het
Rbsn A G 6: 92,170,958 (GRCm39) V321A probably damaging Het
Slc40a1 C A 1: 45,964,383 (GRCm39) C14F probably damaging Het
Slc6a15 T C 10: 103,229,369 (GRCm39) I136T probably damaging Het
Slc7a4 A G 16: 17,391,227 (GRCm39) I449T probably benign Het
Snrnp48 T A 13: 38,394,165 (GRCm39) probably null Het
Tada2a A G 11: 84,011,973 (GRCm39) Y23H probably benign Het
Tbx15 A T 3: 99,259,508 (GRCm39) S460C possibly damaging Het
Tbx21 C T 11: 96,992,304 (GRCm39) probably null Het
Tmcc2 T G 1: 132,285,534 (GRCm39) T376P probably damaging Het
Tmco4 G A 4: 138,779,815 (GRCm39) C420Y probably damaging Het
Tmem63b T C 17: 45,975,653 (GRCm39) probably benign Het
Tnfrsf1a T C 6: 125,334,356 (GRCm39) S92P possibly damaging Het
Top3b A T 16: 16,704,834 (GRCm39) T397S probably benign Het
Trabd C A 15: 88,967,007 (GRCm39) probably benign Het
Trbv21 A T 6: 41,179,764 (GRCm39) I27L possibly damaging Het
Trim3 C T 7: 105,268,276 (GRCm39) V169M probably damaging Het
Ttn T C 2: 76,807,458 (GRCm39) T92A probably damaging Het
Ttn C T 2: 76,738,860 (GRCm39) S3893N probably benign Het
Uchl4 A T 9: 64,142,821 (GRCm39) I101F possibly damaging Het
Vmn1r5 T A 6: 56,962,583 (GRCm39) M86K probably damaging Het
Vmn2r55 T A 7: 12,404,830 (GRCm39) Q191L possibly damaging Het
Zfp458 A T 13: 67,406,012 (GRCm39) C139* probably null Het
Zfp788 T C 7: 41,299,551 (GRCm39) L729P probably damaging Het
Zmym2 T A 14: 57,158,102 (GRCm39) M547K possibly damaging Het
Other mutations in Tmem235
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Tmem235 APN 11 117,753,132 (GRCm39) missense possibly damaging 0.95
R0497:Tmem235 UTSW 11 117,755,177 (GRCm39) missense probably benign 0.01
R0564:Tmem235 UTSW 11 117,751,674 (GRCm39) missense possibly damaging 0.86
R3778:Tmem235 UTSW 11 117,753,126 (GRCm39) missense probably benign 0.08
R6064:Tmem235 UTSW 11 117,753,764 (GRCm39) missense possibly damaging 0.84
R7139:Tmem235 UTSW 11 117,751,723 (GRCm39) missense probably damaging 0.99
R7567:Tmem235 UTSW 11 117,754,967 (GRCm39) missense probably benign 0.04
R7884:Tmem235 UTSW 11 117,755,033 (GRCm39) missense probably benign 0.08
R7904:Tmem235 UTSW 11 117,751,717 (GRCm39) missense probably damaging 1.00
R9332:Tmem235 UTSW 11 117,751,665 (GRCm39) missense probably damaging 1.00
X0063:Tmem235 UTSW 11 117,753,120 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGAGGCAAAGGTGGTCTCTG -3'
(R):5'- TTCCGACAAATGTCAAAGGTG -3'

Sequencing Primer
(F):5'- CAAAGGTGGTCTCTGGGAGG -3'
(R):5'- CCTGTTACACTGGGACTCAGAG -3'
Posted On 2016-08-04