Incidental Mutation 'R0486:Rnf17'
ID42304
Institutional Source Beutler Lab
Gene Symbol Rnf17
Ensembl Gene ENSMUSG00000000365
Gene Namering finger protein 17
SynonymsMMIP-2
MMRRC Submission 038685-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.384) question?
Stock #R0486 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56402581-56525032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56514175 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1490 (T1490M)
Ref Sequence ENSEMBL: ENSMUSP00000093469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095793]
Predicted Effect probably benign
Transcript: ENSMUST00000095793
AA Change: T1490M

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: T1490M

DomainStartEndE-ValueType
Blast:RING 9 72 2e-15 BLAST
low complexity region 398 405 N/A INTRINSIC
Pfam:TUDOR 440 522 8.2e-8 PFAM
TUDOR 750 807 4.32e-12 SMART
low complexity region 824 836 N/A INTRINSIC
Blast:TUDOR 850 882 1e-8 BLAST
low complexity region 959 970 N/A INTRINSIC
TUDOR 984 1042 1.29e-1 SMART
low complexity region 1128 1139 N/A INTRINSIC
TUDOR 1245 1301 7.7e-9 SMART
low complexity region 1416 1430 N/A INTRINSIC
TUDOR 1495 1554 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225737
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco1 T C 4: 40,177,783 L268P probably damaging Het
Adam22 A T 5: 8,330,048 H83Q probably damaging Het
Anln T C 9: 22,352,826 D886G probably benign Het
Arhgef11 T A 3: 87,688,852 probably null Het
Arl8b A T 6: 108,815,326 D116V possibly damaging Het
BC051665 C T 13: 60,784,045 G180D probably damaging Het
Bloc1s2 A G 19: 44,143,150 probably benign Het
Ccdc185 T G 1: 182,747,859 S422R possibly damaging Het
Cd101 T C 3: 101,008,092 K720E possibly damaging Het
Cdh23 C A 10: 60,386,946 A1236S probably damaging Het
Chd1 G A 17: 15,734,342 A491T probably damaging Het
Chdh T C 14: 30,032,858 V275A possibly damaging Het
Cmtm2b A T 8: 104,330,415 I136F probably damaging Het
Cps1 T C 1: 67,165,392 V457A probably damaging Het
Cwf19l1 A G 19: 44,114,690 V362A probably benign Het
Cyp4f17 T C 17: 32,524,823 probably benign Het
Cyp4f18 C A 8: 71,996,017 V263L probably benign Het
Dclre1a A G 19: 56,541,490 probably benign Het
Dpp6 T C 5: 27,661,642 I446T probably benign Het
F11r T C 1: 171,460,588 W61R probably damaging Het
Fam120b C T 17: 15,426,288 probably benign Het
Fastkd2 T C 1: 63,752,340 V669A possibly damaging Het
Foxg1 T C 12: 49,384,531 probably benign Het
Foxo3 A G 10: 42,197,481 Y347H probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gbp7 C A 3: 142,546,317 probably benign Het
Glipr1 T C 10: 111,996,849 probably benign Het
Gm11555 A G 11: 99,650,160 S8P unknown Het
H6pd G A 4: 149,982,936 probably benign Het
Haus8 C A 8: 71,256,537 G76W probably damaging Het
Haus8 C T 8: 71,256,538 M75I probably benign Het
Kcnj13 C A 1: 87,387,030 V157L probably damaging Het
Kcnt2 T A 1: 140,509,480 C550* probably null Het
Kdm5d A G Y: 927,107 N615S probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Ngef T A 1: 87,479,126 N640I probably damaging Het
Nhlrc3 T C 3: 53,452,437 Y335C probably damaging Het
Nipbl A T 15: 8,338,870 probably benign Het
Nop2 A G 6: 125,140,673 K434R probably null Het
Nr4a3 T C 4: 48,056,525 probably benign Het
Olfr881 A G 9: 37,992,702 N70S possibly damaging Het
Piezo2 A C 18: 63,029,061 I2233R probably damaging Het
Prag1 A T 8: 36,146,633 E1113V probably damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Psmd1 T A 1: 86,094,290 N611K probably damaging Het
Ptpn7 C T 1: 135,137,358 T168I probably damaging Het
Pus1 A T 5: 110,779,730 V53E probably damaging Het
Rgs22 A G 15: 36,092,882 M415T probably damaging Het
Rnf165 T A 18: 77,484,254 Q91L probably damaging Het
Rnf20 C A 4: 49,645,907 L332I possibly damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spam1 A T 6: 24,796,395 Q115L probably damaging Het
Syce1l A T 8: 113,654,763 probably null Het
Synj1 T C 16: 90,938,263 probably benign Het
Tas2r126 A T 6: 42,435,291 I253F probably benign Het
Tecpr2 G A 12: 110,896,369 V72I probably benign Het
Tfap2a G T 13: 40,728,694 P45Q probably damaging Het
Trip12 C A 1: 84,761,084 G714* probably null Het
Wdr31 A G 4: 62,453,893 S330P probably damaging Het
Wdr64 T C 1: 175,795,203 probably benign Het
Yes1 T A 5: 32,655,582 Y343* probably null Het
Other mutations in Rnf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Rnf17 APN 14 56421082 missense probably damaging 0.99
IGL00717:Rnf17 APN 14 56465750 missense probably benign 0.00
IGL00978:Rnf17 APN 14 56512271 missense probably damaging 1.00
IGL01295:Rnf17 APN 14 56463064 nonsense probably null
IGL01779:Rnf17 APN 14 56462063 missense probably benign 0.06
IGL02132:Rnf17 APN 14 56421166 missense probably benign 0.27
IGL02183:Rnf17 APN 14 56507868 missense probably null 0.99
IGL02387:Rnf17 APN 14 56500587 missense probably damaging 1.00
IGL02422:Rnf17 APN 14 56482135 missense probably damaging 1.00
IGL03081:Rnf17 APN 14 56434371 missense probably benign 0.03
IGL03269:Rnf17 APN 14 56427946 missense possibly damaging 0.74
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0089:Rnf17 UTSW 14 56514106 missense probably damaging 1.00
R0189:Rnf17 UTSW 14 56482193 missense probably null 1.00
R0243:Rnf17 UTSW 14 56482084 missense possibly damaging 0.80
R0245:Rnf17 UTSW 14 56438609 missense probably damaging 0.97
R0554:Rnf17 UTSW 14 56522550 missense probably damaging 1.00
R0840:Rnf17 UTSW 14 56475447 missense probably damaging 1.00
R1169:Rnf17 UTSW 14 56514165 missense possibly damaging 0.89
R1170:Rnf17 UTSW 14 56425631 missense probably benign 0.10
R1200:Rnf17 UTSW 14 56467706 missense probably benign 0.44
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1472:Rnf17 UTSW 14 56427979 missense probably damaging 1.00
R1512:Rnf17 UTSW 14 56467786 missense probably benign 0.01
R1605:Rnf17 UTSW 14 56493365 missense probably damaging 1.00
R1778:Rnf17 UTSW 14 56522399 missense probably damaging 0.99
R1791:Rnf17 UTSW 14 56504007 nonsense probably null
R2015:Rnf17 UTSW 14 56486969 missense probably benign 0.00
R2023:Rnf17 UTSW 14 56431579 missense possibly damaging 0.59
R2086:Rnf17 UTSW 14 56483380 missense probably damaging 0.98
R2130:Rnf17 UTSW 14 56493354 missense probably damaging 1.00
R2309:Rnf17 UTSW 14 56505982 missense possibly damaging 0.95
R3003:Rnf17 UTSW 14 56500547 missense probably damaging 1.00
R3611:Rnf17 UTSW 14 56467740 missense probably benign 0.43
R3847:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3848:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3849:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3850:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3872:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R3874:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R4021:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4022:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4790:Rnf17 UTSW 14 56434355 missense probably damaging 1.00
R4951:Rnf17 UTSW 14 56522391 missense probably benign 0.02
R5068:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5069:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5070:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5518:Rnf17 UTSW 14 56482133 missense probably damaging 1.00
R5628:Rnf17 UTSW 14 56486952 splice site probably null
R5712:Rnf17 UTSW 14 56471399 missense probably benign 0.19
R5747:Rnf17 UTSW 14 56465819 critical splice donor site probably null
R5869:Rnf17 UTSW 14 56505988 missense possibly damaging 0.94
R6336:Rnf17 UTSW 14 56421169 splice site probably null
R6626:Rnf17 UTSW 14 56427924 missense possibly damaging 0.92
R6639:Rnf17 UTSW 14 56438743 missense probably benign 0.01
R6675:Rnf17 UTSW 14 56459975 missense probably damaging 1.00
R6731:Rnf17 UTSW 14 56524350 missense possibly damaging 0.93
R7062:Rnf17 UTSW 14 56465654 missense probably benign 0.00
R7103:Rnf17 UTSW 14 56471306 missense possibly damaging 0.63
R7144:Rnf17 UTSW 14 56512332 splice site probably null
R7527:Rnf17 UTSW 14 56516438 missense probably damaging 1.00
R7664:Rnf17 UTSW 14 56438878 missense probably damaging 1.00
R7754:Rnf17 UTSW 14 56462072 critical splice donor site probably null
R7772:Rnf17 UTSW 14 56477687 missense probably benign 0.27
R8092:Rnf17 UTSW 14 56487022 missense probably benign 0.00
R8150:Rnf17 UTSW 14 56421136 missense probably benign 0.19
R8203:Rnf17 UTSW 14 56467722 missense probably benign 0.17
R8320:Rnf17 UTSW 14 56424542 frame shift probably null
R8321:Rnf17 UTSW 14 56424542 frame shift probably null
R8379:Rnf17 UTSW 14 56424542 frame shift probably null
R8380:Rnf17 UTSW 14 56424542 frame shift probably null
R8381:Rnf17 UTSW 14 56424542 frame shift probably null
R8382:Rnf17 UTSW 14 56424542 frame shift probably null
R8383:Rnf17 UTSW 14 56424542 frame shift probably null
Z1177:Rnf17 UTSW 14 56467706 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GCGGTCTCTTGGTACAAGATCAGTG -3'
(R):5'- AGTCATGCAGAGCAGAACTGTCCC -3'

Sequencing Primer
(F):5'- CGTTCCAGAAATGGCAGAATC -3'
(R):5'- GATGATTAACTCACTTGGGTCACC -3'
Posted On2013-05-23