Incidental Mutation 'R5364:Arfgap3'
ID423048
Institutional Source Beutler Lab
Gene Symbol Arfgap3
Ensembl Gene ENSMUSG00000054277
Gene NameADP-ribosylation factor GTPase activating protein 3
Synonyms1810004P07Rik, 0610009H19Rik, 1810035F16Rik, 9130416J18Rik
MMRRC Submission 042942-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R5364 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location83299739-83350247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 83314361 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 307 (M307R)
Ref Sequence ENSEMBL: ENSMUSP00000154712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067215] [ENSMUST00000226124]
Predicted Effect probably damaging
Transcript: ENSMUST00000067215
AA Change: M307R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064893
Gene: ENSMUSG00000054277
AA Change: M307R

DomainStartEndE-ValueType
ArfGap 10 126 7.18e-44 SMART
Blast:ArfGap 160 200 2e-6 BLAST
low complexity region 220 237 N/A INTRINSIC
low complexity region 348 362 N/A INTRINSIC
low complexity region 459 466 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226124
AA Change: M307R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7131 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.3%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase-activating protein (GAP) that associates with the Golgi apparatus and regulates the early secretory pathway of proteins. The encoded protein promotes hydrolysis of ADP-ribosylation factor 1 (ARF1)-bound GTP, which is required for the dissociation of coat proteins from Golgi-derived membranes and vesicles. Dissociation of the coat proteins is a prerequisite for the fusion of these vesicles with target compartments. The activity of this protein is sensitive to phospholipids. Multiple transcript variants encoding different isoforms have been found for this gene. This gene was originally known as ARFGAP1, but that is now the name of a related but different gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C G 7: 27,578,767 T242R probably damaging Het
Abcc10 G A 17: 46,305,651 R1205C probably benign Het
Acer1 A G 17: 56,982,000 F37L probably damaging Het
Acp7 C A 7: 28,611,023 G463V probably benign Het
Actr2 A T 11: 20,100,797 probably benign Het
Adam15 A T 3: 89,345,595 I272K probably damaging Het
Adam1b T A 5: 121,500,883 I700F possibly damaging Het
Adam33 A G 2: 131,054,472 probably null Het
Ano1 T C 7: 144,637,204 Y380C probably damaging Het
Arhgap21 T A 2: 20,849,722 R1610W probably damaging Het
Bbs2 A G 8: 94,074,395 Y603H probably benign Het
Bbs9 G T 9: 22,575,196 probably null Het
Bcar3 A C 3: 122,529,632 M779L probably benign Het
Bub3 A T 7: 131,560,738 N10I possibly damaging Het
Cacna1c T G 6: 118,656,543 E1098D probably benign Het
Cacna1g T A 11: 94,416,858 M1738L probably benign Het
Camk2d G T 3: 126,780,420 G159C probably damaging Het
Ccdc114 T A 7: 45,936,332 I105N probably damaging Het
Ccdc51 A T 9: 109,092,120 E358D possibly damaging Het
Cdc42bpa A G 1: 180,067,182 D309G probably benign Het
Cdhr3 A T 12: 33,051,008 F468I possibly damaging Het
Chrd A G 16: 20,733,148 M1V probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcdc2b T C 4: 129,609,170 Y253C probably damaging Het
Dclk1 A C 3: 55,255,945 N153H possibly damaging Het
Dgkg G T 16: 22,600,461 S96R probably benign Het
Dnah9 A G 11: 65,881,696 Y3737H possibly damaging Het
Elovl4 A T 9: 83,790,023 I81N probably benign Het
Epha7 T A 4: 28,950,557 Y791N probably damaging Het
Fam105a G A 15: 27,659,945 Q24* probably null Het
Fam193a C A 5: 34,466,253 T1395N probably benign Het
Fbln5 A T 12: 101,771,364 V141E probably damaging Het
Flii T C 11: 60,720,128 T492A probably benign Het
Fnip2 A G 3: 79,481,168 I752T probably benign Het
Fpr3 T C 17: 17,970,544 W26R probably benign Het
Gabrb1 A T 5: 72,136,762 T460S probably benign Het
Gde1 T C 7: 118,698,651 N4S probably benign Het
Ghitm G T 14: 37,125,199 T306K probably benign Het
Ghitm A T 14: 37,125,217 I300N probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Iqcd T C 5: 120,600,267 I50T probably damaging Het
Itpripl1 G A 2: 127,141,819 P128S possibly damaging Het
Jag2 C A 12: 112,910,534 L1000F probably damaging Het
Klhdc4 A T 8: 121,806,636 probably benign Het
Klra5 A G 6: 129,899,353 F164L probably benign Het
Larp1b A G 3: 40,977,223 Y288C probably damaging Het
Lrfn3 T A 7: 30,355,653 E622D possibly damaging Het
Lyst A G 13: 13,656,854 D1621G probably benign Het
Mastl T C 2: 23,133,653 T353A probably benign Het
Mkln1 T C 6: 31,496,712 Y130H probably damaging Het
Mms22l T A 4: 24,496,882 probably benign Het
Mroh7 T A 4: 106,691,643 M1008L probably benign Het
Nipal1 T C 5: 72,667,900 V312A probably damaging Het
Nlrp5 T A 7: 23,418,328 Y492* probably null Het
Olfr351 T C 2: 36,859,994 Y118C probably damaging Het
Pcdhb11 T A 18: 37,422,179 D187E probably benign Het
Pcdhb13 A G 18: 37,443,508 Y313C probably damaging Het
Pdpn G A 4: 143,273,956 T102I possibly damaging Het
Pear1 A T 3: 87,758,361 C120S probably damaging Het
Peg10 T C 6: 4,756,128 probably benign Het
Ppm1e A G 11: 87,237,181 W384R probably benign Het
Ppp1r10 C T 17: 35,930,432 P700S unknown Het
Prl2c5 G A 13: 13,183,042 R13K probably benign Het
Prmt3 C A 7: 49,848,806 P487T probably damaging Het
Proser3 C A 7: 30,546,148 A144S possibly damaging Het
Ptcd1 G A 5: 145,151,431 T590I probably damaging Het
Rbsn A G 6: 92,193,977 V321A probably damaging Het
Slc40a1 C A 1: 45,925,223 C14F probably damaging Het
Slc6a15 T C 10: 103,393,508 I136T probably damaging Het
Slc7a4 A G 16: 17,573,363 I449T probably benign Het
Snrnp48 T A 13: 38,210,189 probably null Het
Tada2a A G 11: 84,121,147 Y23H probably benign Het
Tbx15 A T 3: 99,352,192 S460C possibly damaging Het
Tbx21 C T 11: 97,101,478 probably null Het
Tmcc2 T G 1: 132,357,796 T376P probably damaging Het
Tmco4 G A 4: 139,052,504 C420Y probably damaging Het
Tmem235 C A 11: 117,864,194 Y157* probably null Het
Tmem63b T C 17: 45,664,727 probably benign Het
Tnfrsf1a T C 6: 125,357,393 S92P possibly damaging Het
Top3b A T 16: 16,886,970 T397S probably benign Het
Trabd C A 15: 89,082,804 probably benign Het
Trbv21 A T 6: 41,202,830 I27L possibly damaging Het
Trim3 C T 7: 105,619,069 V169M probably damaging Het
Ttn C T 2: 76,908,516 S3893N probably benign Het
Ttn T C 2: 76,977,114 T92A probably damaging Het
Uchl4 A T 9: 64,235,539 I101F possibly damaging Het
Vmn1r5 T A 6: 56,985,598 M86K probably damaging Het
Vmn2r55 T A 7: 12,670,903 Q191L possibly damaging Het
Zfp458 A T 13: 67,257,948 C139* probably null Het
Zfp788 T C 7: 41,650,127 L729P probably damaging Het
Zmym2 T A 14: 56,920,645 M547K possibly damaging Het
Other mutations in Arfgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Arfgap3 APN 15 83322589 missense probably benign 0.04
IGL01306:Arfgap3 APN 15 83313509 missense possibly damaging 0.78
IGL01960:Arfgap3 APN 15 83313557 missense probably benign 0.04
IGL03029:Arfgap3 APN 15 83322650 missense probably damaging 1.00
IGL03036:Arfgap3 APN 15 83306926 missense possibly damaging 0.91
IGL03328:Arfgap3 APN 15 83343081 missense probably damaging 1.00
ANU23:Arfgap3 UTSW 15 83313509 missense possibly damaging 0.78
R0103:Arfgap3 UTSW 15 83322721 splice site probably benign
R0103:Arfgap3 UTSW 15 83322721 splice site probably benign
R0125:Arfgap3 UTSW 15 83343139 missense probably benign 0.01
R0243:Arfgap3 UTSW 15 83330513 splice site probably benign
R0551:Arfgap3 UTSW 15 83343137 missense probably damaging 1.00
R0557:Arfgap3 UTSW 15 83303185 missense probably damaging 1.00
R0638:Arfgap3 UTSW 15 83308188 splice site probably null
R1115:Arfgap3 UTSW 15 83330540 missense probably benign 0.00
R1459:Arfgap3 UTSW 15 83306937 missense probably benign 0.15
R1576:Arfgap3 UTSW 15 83313563 missense possibly damaging 0.94
R1776:Arfgap3 UTSW 15 83343139 missense probably benign 0.01
R1826:Arfgap3 UTSW 15 83303102 critical splice donor site probably null
R2057:Arfgap3 UTSW 15 83310300 missense probably benign
R2084:Arfgap3 UTSW 15 83334566 missense probably damaging 0.96
R3407:Arfgap3 UTSW 15 83322607 missense probably benign 0.00
R4072:Arfgap3 UTSW 15 83303129 missense probably damaging 1.00
R4074:Arfgap3 UTSW 15 83303129 missense probably damaging 1.00
R4206:Arfgap3 UTSW 15 83322668 missense probably benign
R4449:Arfgap3 UTSW 15 83334558 missense probably damaging 1.00
R5004:Arfgap3 UTSW 15 83310296 missense possibly damaging 0.87
R5193:Arfgap3 UTSW 15 83332697 missense probably benign 0.01
R6142:Arfgap3 UTSW 15 83350127 missense probably damaging 1.00
R6813:Arfgap3 UTSW 15 83330593 missense probably benign 0.00
R7154:Arfgap3 UTSW 15 83336704 missense probably damaging 1.00
R7422:Arfgap3 UTSW 15 83306949 missense probably damaging 0.97
R7582:Arfgap3 UTSW 15 83303101 missense possibly damaging 0.77
R7714:Arfgap3 UTSW 15 83308151 missense probably benign 0.34
Z1177:Arfgap3 UTSW 15 83332688 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAATGGCCTTGAGTGGATC -3'
(R):5'- CTGCCTGTGATTTCAATGCAAGG -3'

Sequencing Primer
(F):5'- TTGAGTGGATCCCCAGCCTTG -3'
(R):5'- TCAATGCAAGGCCACAGTGTTTG -3'
Posted On2016-08-04