Incidental Mutation 'R5364:Chrd'
ID423052
Institutional Source Beutler Lab
Gene Symbol Chrd
Ensembl Gene ENSMUSG00000006958
Gene Namechordin
SynonymsChd
MMRRC Submission 042942-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5364 (G1)
Quality Score121
Status Validated
Chromosome16
Chromosomal Location20733127-20742384 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 20733148 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000156323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007171] [ENSMUST00000076422] [ENSMUST00000115423] [ENSMUST00000115437] [ENSMUST00000153299] [ENSMUST00000231636] [ENSMUST00000231698] [ENSMUST00000231826] [ENSMUST00000232217] [ENSMUST00000232646]
Predicted Effect probably null
Transcript: ENSMUST00000007171
AA Change: M1V
SMART Domains Protein: ENSMUSP00000007171
Gene: ENSMUSG00000006958
AA Change: M1V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 643 2.03e-31 SMART
low complexity region 676 687 N/A INTRINSIC
VWC 701 758 4.69e-10 SMART
VWC 779 845 5.3e-9 SMART
VWC 867 927 1.68e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076422
SMART Domains Protein: ENSMUSP00000075756
Gene: ENSMUSG00000022847

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EPO_TPO 24 188 9.4e-78 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115423
AA Change: M1V
SMART Domains Protein: ENSMUSP00000111083
Gene: ENSMUSG00000006958
AA Change: M1V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 605 3.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115437
SMART Domains Protein: ENSMUSP00000111097
Gene: ENSMUSG00000022847

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EPO_TPO 25 193 5.4e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151150
Predicted Effect probably null
Transcript: ENSMUST00000153299
AA Change: M1V
SMART Domains Protein: ENSMUSP00000138259
Gene: ENSMUSG00000006958
AA Change: M1V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
Blast:CHRD 170 236 1e-21 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000231636
AA Change: M1V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231689
Predicted Effect probably null
Transcript: ENSMUST00000231698
AA Change: M1V

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000231826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232104
Predicted Effect probably benign
Transcript: ENSMUST00000232217
Predicted Effect probably null
Transcript: ENSMUST00000232646
AA Change: M1V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.9528 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.3%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein that dorsalizes early vertebrate embryonic tissues by binding to ventralizing TGF-beta-like bone morphogenetic proteins and sequestering them in latent complexes. The encoded protein may also have roles in organogenesis and during adulthood. It has been suggested that this gene could be a candidate gene for Cornelia de Lange syndrome. Reduced expression of this gene results in enhanced bone regeneration. Alternative splicing results in multiple transcript variants. Other alternative splice variants have been described but their full length sequence has not been determined. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted null mutation show some death prior to embryonic day 8.5, but most die perinatally with abnormalities of the skull, malformations of cervical and thoracic vertebrae, cardiovascular defects, and absence of parathyroid and thymus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C G 7: 27,578,767 T242R probably damaging Het
Abcc10 G A 17: 46,305,651 R1205C probably benign Het
Acer1 A G 17: 56,982,000 F37L probably damaging Het
Acp7 C A 7: 28,611,023 G463V probably benign Het
Actr2 A T 11: 20,100,797 probably benign Het
Adam15 A T 3: 89,345,595 I272K probably damaging Het
Adam1b T A 5: 121,500,883 I700F possibly damaging Het
Adam33 A G 2: 131,054,472 probably null Het
Ano1 T C 7: 144,637,204 Y380C probably damaging Het
Arfgap3 A C 15: 83,314,361 M307R probably damaging Het
Arhgap21 T A 2: 20,849,722 R1610W probably damaging Het
Bbs2 A G 8: 94,074,395 Y603H probably benign Het
Bbs9 G T 9: 22,575,196 probably null Het
Bcar3 A C 3: 122,529,632 M779L probably benign Het
Bub3 A T 7: 131,560,738 N10I possibly damaging Het
Cacna1c T G 6: 118,656,543 E1098D probably benign Het
Cacna1g T A 11: 94,416,858 M1738L probably benign Het
Camk2d G T 3: 126,780,420 G159C probably damaging Het
Ccdc114 T A 7: 45,936,332 I105N probably damaging Het
Ccdc51 A T 9: 109,092,120 E358D possibly damaging Het
Cdc42bpa A G 1: 180,067,182 D309G probably benign Het
Cdhr3 A T 12: 33,051,008 F468I possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcdc2b T C 4: 129,609,170 Y253C probably damaging Het
Dclk1 A C 3: 55,255,945 N153H possibly damaging Het
Dgkg G T 16: 22,600,461 S96R probably benign Het
Dnah9 A G 11: 65,881,696 Y3737H possibly damaging Het
Elovl4 A T 9: 83,790,023 I81N probably benign Het
Epha7 T A 4: 28,950,557 Y791N probably damaging Het
Fam105a G A 15: 27,659,945 Q24* probably null Het
Fam193a C A 5: 34,466,253 T1395N probably benign Het
Fbln5 A T 12: 101,771,364 V141E probably damaging Het
Flii T C 11: 60,720,128 T492A probably benign Het
Fnip2 A G 3: 79,481,168 I752T probably benign Het
Fpr3 T C 17: 17,970,544 W26R probably benign Het
Gabrb1 A T 5: 72,136,762 T460S probably benign Het
Gde1 T C 7: 118,698,651 N4S probably benign Het
Ghitm G T 14: 37,125,199 T306K probably benign Het
Ghitm A T 14: 37,125,217 I300N probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Iqcd T C 5: 120,600,267 I50T probably damaging Het
Itpripl1 G A 2: 127,141,819 P128S possibly damaging Het
Jag2 C A 12: 112,910,534 L1000F probably damaging Het
Klhdc4 A T 8: 121,806,636 probably benign Het
Klra5 A G 6: 129,899,353 F164L probably benign Het
Larp1b A G 3: 40,977,223 Y288C probably damaging Het
Lrfn3 T A 7: 30,355,653 E622D possibly damaging Het
Lyst A G 13: 13,656,854 D1621G probably benign Het
Mastl T C 2: 23,133,653 T353A probably benign Het
Mkln1 T C 6: 31,496,712 Y130H probably damaging Het
Mms22l T A 4: 24,496,882 probably benign Het
Mroh7 T A 4: 106,691,643 M1008L probably benign Het
Nipal1 T C 5: 72,667,900 V312A probably damaging Het
Nlrp5 T A 7: 23,418,328 Y492* probably null Het
Olfr351 T C 2: 36,859,994 Y118C probably damaging Het
Pcdhb11 T A 18: 37,422,179 D187E probably benign Het
Pcdhb13 A G 18: 37,443,508 Y313C probably damaging Het
Pdpn G A 4: 143,273,956 T102I possibly damaging Het
Pear1 A T 3: 87,758,361 C120S probably damaging Het
Peg10 T C 6: 4,756,128 probably benign Het
Ppm1e A G 11: 87,237,181 W384R probably benign Het
Ppp1r10 C T 17: 35,930,432 P700S unknown Het
Prl2c5 G A 13: 13,183,042 R13K probably benign Het
Prmt3 C A 7: 49,848,806 P487T probably damaging Het
Proser3 C A 7: 30,546,148 A144S possibly damaging Het
Ptcd1 G A 5: 145,151,431 T590I probably damaging Het
Rbsn A G 6: 92,193,977 V321A probably damaging Het
Slc40a1 C A 1: 45,925,223 C14F probably damaging Het
Slc6a15 T C 10: 103,393,508 I136T probably damaging Het
Slc7a4 A G 16: 17,573,363 I449T probably benign Het
Snrnp48 T A 13: 38,210,189 probably null Het
Tada2a A G 11: 84,121,147 Y23H probably benign Het
Tbx15 A T 3: 99,352,192 S460C possibly damaging Het
Tbx21 C T 11: 97,101,478 probably null Het
Tmcc2 T G 1: 132,357,796 T376P probably damaging Het
Tmco4 G A 4: 139,052,504 C420Y probably damaging Het
Tmem235 C A 11: 117,864,194 Y157* probably null Het
Tmem63b T C 17: 45,664,727 probably benign Het
Tnfrsf1a T C 6: 125,357,393 S92P possibly damaging Het
Top3b A T 16: 16,886,970 T397S probably benign Het
Trabd C A 15: 89,082,804 probably benign Het
Trbv21 A T 6: 41,202,830 I27L possibly damaging Het
Trim3 C T 7: 105,619,069 V169M probably damaging Het
Ttn C T 2: 76,908,516 S3893N probably benign Het
Ttn T C 2: 76,977,114 T92A probably damaging Het
Uchl4 A T 9: 64,235,539 I101F possibly damaging Het
Vmn1r5 T A 6: 56,985,598 M86K probably damaging Het
Vmn2r55 T A 7: 12,670,903 Q191L possibly damaging Het
Zfp458 A T 13: 67,257,948 C139* probably null Het
Zfp788 T C 7: 41,650,127 L729P probably damaging Het
Zmym2 T A 14: 56,920,645 M547K possibly damaging Het
Other mutations in Chrd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Chrd APN 16 20741225 missense possibly damaging 0.89
IGL01486:Chrd APN 16 20734140 splice site probably null
IGL02120:Chrd APN 16 20734541 missense probably damaging 1.00
IGL02370:Chrd APN 16 20735791 missense possibly damaging 0.52
IGL02675:Chrd APN 16 20739949 splice site probably benign
IGL02678:Chrd APN 16 20734020 missense probably damaging 1.00
IGL02874:Chrd APN 16 20735196 missense probably damaging 1.00
ANU74:Chrd UTSW 16 20741319 missense possibly damaging 0.88
PIT1430001:Chrd UTSW 16 20738998 critical splice donor site probably null
R0016:Chrd UTSW 16 20734308 missense possibly damaging 0.85
R0230:Chrd UTSW 16 20733275 missense probably benign 0.25
R0605:Chrd UTSW 16 20735439 missense probably damaging 1.00
R0831:Chrd UTSW 16 20741309 missense probably damaging 0.99
R1501:Chrd UTSW 16 20737533 missense probably damaging 1.00
R1659:Chrd UTSW 16 20735831 missense probably damaging 0.96
R1766:Chrd UTSW 16 20737441 missense probably damaging 1.00
R1823:Chrd UTSW 16 20741347 splice site probably benign
R3001:Chrd UTSW 16 20737445 nonsense probably null
R3002:Chrd UTSW 16 20737445 nonsense probably null
R3874:Chrd UTSW 16 20738910 missense probably damaging 0.99
R4319:Chrd UTSW 16 20737048 missense probably damaging 0.99
R4587:Chrd UTSW 16 20738575 missense possibly damaging 0.58
R4707:Chrd UTSW 16 20738808 missense possibly damaging 0.58
R4857:Chrd UTSW 16 20738758 missense possibly damaging 0.79
R5204:Chrd UTSW 16 20736072 missense probably benign 0.02
R5445:Chrd UTSW 16 20738910 missense possibly damaging 0.74
R5611:Chrd UTSW 16 20738974 missense probably damaging 1.00
R5940:Chrd UTSW 16 20734586 missense probably null 0.01
R6004:Chrd UTSW 16 20735237 missense possibly damaging 0.92
R6767:Chrd UTSW 16 20738626 missense probably benign 0.00
R6798:Chrd UTSW 16 20734306 missense probably damaging 1.00
R6801:Chrd UTSW 16 20735747 missense possibly damaging 0.68
R6823:Chrd UTSW 16 20734736 missense probably damaging 1.00
R6999:Chrd UTSW 16 20735652 missense probably benign
R7069:Chrd UTSW 16 20739433 missense probably damaging 1.00
R7136:Chrd UTSW 16 20734522 missense possibly damaging 0.82
R7273:Chrd UTSW 16 20741566 missense probably benign 0.32
R7558:Chrd UTSW 16 20738554 missense probably damaging 1.00
R7813:Chrd UTSW 16 20735405 missense probably benign 0.00
R7965:Chrd UTSW 16 20739153 missense probably benign 0.05
R8361:Chrd UTSW 16 20738737 missense possibly damaging 0.92
R8549:Chrd UTSW 16 20741277 missense probably benign 0.40
R8809:Chrd UTSW 16 20734520 missense probably benign 0.19
X0063:Chrd UTSW 16 20737564 critical splice donor site probably null
Z1088:Chrd UTSW 16 20741255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTAAAGTGGAGTACGGC -3'
(R):5'- ACTTGCCAGGAGTCAGACTC -3'

Sequencing Primer
(F):5'- AGTACGGCCCGGGTCAG -3'
(R):5'- AGTCAGACTCCCCTCCCG -3'
Posted On2016-08-04